Apparently: "poly(A) tails at the 3' end of RNA are not an unusual feature of viruses. Eukaryotic mRNA almost always contains poly(A) tails, which are added post-transcriptionally in a process known as polyadenylation. It should not therefore be surprising that positive-strand RNA viruses would have poly(A) tails as well. In eukaryotic mRNA, the central sequence motif for identifying a polyadenylation region is AAUAAA, identified way back in the 1970s, with more recent research confirming its ubiquity. Proudfoot 2011 is a nice review article on poly(A) signals in eukaryotic mRNA."
Edit: A more recent (2017) study than Proudfoot 2011 offers the perspective that the process may be more tissue specific. From Tian B., Manley J.L. Alternative polyadenylation of mRNA precursors. Nat. Rev. Mol. Cell Biol. 2016; 18:18–30:
Alternative polyadenylation (APA) is an RNA-processing mechanism that generates distinct 3′ termini on mRNAs and other RNA polymerase II transcripts. It is widespread across all eukaryotic species and is recognized as a major mechanism of gene regulation. APA exhibits tissue specificity and is important for cell proliferation and differentiation. In this Review, we discuss the roles of APA in diverse cellular processes, including mRNA metabolism, protein diversification and protein localization, and more generally in gene regulation. We also discuss the molecular mechanisms underlying APA, such as variation in the concentration of core processing factors and RNA-binding proteins, as well as transcription-based regulation.
The generally accepted term for this type of comment is "karma whoring", an attempt to garner upvotes for the erudite and enlightening explanation of the phenomenon by quoting the article itself. This works for those who suffer from 'TL,DR' but it fails on those who actually read before they comment.
My comment was mocking people who would see this, which has a clear scientific explanation, as evidence for their conspiracy theories. I'm not that stupid and I don't think anyone on HN is. Smh downvoters.
I think you were downvoted for mocking, not for being stupid. I've found this community doesn't like mocking, sarcasm or poorly executed satire -- or rather, all my attempts fail.
No one has proven that this virus is any more deadly than a bad flu. 3-4% of hospitalized cases is not absurd compared to the yearly flu. Very interesting, all of this
They have actually done the exact opposite. They knew about this way back in December,
the numbers they report are wauly understated and they have even arrested reporters and made them delete their footage.
China is all about showing a good image to the rest of the world and their own population, and this outbreak goes in the face of that.
Totalitarian sometimes work. Just watch ww2 in Color. Nazi worked and got France. It is just sometimes. When you do not have freedom of speech and media, this follow the leader would not work. Anyway. Last time we wait for the hot weather to kill this. And they did start to close down cities. We just hope the totalitarian plus the nature of people (just run say to HK) would not hurt too much until nature stop it.
Except the mortality rate is insignificant, it's just a novel virus with less serious consequences than the flu from what I've read.
The scale of the reaction and coverage seems entirely disconnected from its actual impact. Is there any point in wasting any resources at all in containing such a virus beyond just exercising your ability to do so?
We don't know the mortality rate, because you can't trust anything coming from China's government. It takes a certain amount of time for the virus to kill and that time hasn't passed yet.
A disease that makes you cough up blood, is highly mutable and can be spread for 2 weeks prior to experiencing symptoms is not to be dismissed as just the same as a flu.
"The percentage of deaths attributed to pneumonia and influenza decreased from 7.1% to 6.7% and is below the epidemic threshold."
That's not mortality rate. You make it sound like 7% of those with flu will die. Instead it means that 7% of deaths are because of flu and pneumonia, which still seems high to me though
It blows my mind that we're at a stage of scientific exchange where this kind of discourse and genetic information is so readily available at people's fingertips.
Quite frightening, really, given CRISPR. It's like discussing optimal ways to build a thermonuclear bomb in your kitchen casually in an open, public forum.
Hard to do in a reliable, controlled manner, yes. It's surprisingly easy however to do it messily. To push the analogy further, think about the early atomic piles.
Also note that nuclear requires a certain amount of collection of radioactive material, kind of like gold but much more expensive. Viruses can just be drawn from anyone's blood stream / mucus.
People don't quite realize the catastrophic risk our over educated society can be as we learn more and more about the building blocks of our universe, intelligence, organic makeup or otherwise.
Vernor Vinge discusses it a bit in his latest novels.
What is the scientific requirement that the universe can not be easily meddled with by highly intelligent / knowledgeable agents? The human being did not evolve under circumstances where we had such capability.
Likely our best bet is to spread out to different planets where there would at least be some buffer.
Why CRISPR is relevant here? I thought that synthesizing long DNA/RNA sequences (29903 base pairs here) was a practical limitation for creating bioweapons at home.
It's surprisingly reminiscent of the "leader" and "trailer" of tape and film, and according to the quotes in the link, are required for the transcription process that "reads" the genome. The analogous functionality of reading a genome, and that of a human-made device reading tape or film, is fascinating.
It is interesting. DNA itself could be analogous to the tape that a Turing machine reads one cell at a time. The alphabet in each cell is finite (ATCG).
If you used your nop sled in a stenographic fashion (ie: each type of NOP can be decoded as some piece of information) you would be pretty close when it comes to RNA virus replication. For that matter, some computer viruses purposely mutate the nop sled to avoid creating scan strings, so there are a number of similarities to be had as long as each mutation still performs the necessary function.
The very first nCoV genome sequencied earlier this month[0] ends with 33 As, while the genome of the virus found in the first U.S. patient[1] ends with only 12 As.
Is it normal for there to be variation here? Do these repeated A sequences actually code for a protein or are they just a marker to let the ribosome know it's reached the end of the genome, and so the length of repeating As doesn't really matter past a certain point?
One of the papers mentioned in the linked discussion shows that the number of As can vary over time within a single patient. There seems to be some evidence that different lengths might give an advantage or disadvantage in replication, but it seems like variation is normal.
It's times like these that we come to depend heavily on basic science, that up until now few would have realized is really important. There's a long chain of publications cited in the top answer, that all represent years of person hours trying to discover these behaviors and then share them with the world.
Politicians sometimes ridicule basic research in an attempt to claim that government is irresponsible, and during recent elections it would have been a simple thing to ridicule the idea of studying "how many As are at the end of a viral genome" as an egregious waste of tax funds. Yet here we are.
Basic science without any known applications are how the really big discoveries come about. Sometimes we can guess that an area will be fruitful, but it's now always the case.
Next time somebody attempts to ridicule science as pointless, think back to why anybody might care about a strange pattern of nucleotides at the end of a virus.
I’ll be honest. I don’t feel like studying viral genome patterns is high on anyone’s list of useless science.
My second thought is that the observation of an unnatural pattern would be really important. Naively an early hypothesis might be the something that looks unnatural is man made.
For every 1 such study that ultimately proves useful, I wouldn’t be surprised if 100 (or even 1,000) were an utter waste of time.
Your argument seems to imply a shopaholic hoarder isn’t wasting their lives, just so long as at least sometimes they actually use a random rubber band or a ‘70’s themed valentine card.
Pardon? That's awfully generous you're being with other peoples money. If that's the hit-rate, can you imagine what people could do with the money if it had not been taken from them in taxes? For starters you might simply ask, how many face masks could have been purchased.
Basic research should not be an ivory tower that is isolated from questions of cost vs. benefits.
I would bet that 99+% of arrangements of 33 letters
"look random" -- that is, there is no discernible pattern. Despite each arrangement having an equally tiny probability of occurring, if you randomly generate an arrangement, you're all but guaranteed to get something that looks random.
For aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to appear, it is either an amazing coincidence, or there must be some non-random mechanism that creates it.
> Why would he expect aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to be less random than for example acatgagacgtctaatgttagacatgcatgac?
Can we really consider any part of a genome random? I means your second example isn't part of it, so I guess it's "random" but if you compare any part, it would come from evolution and without this, the virus wouldn't survive most probably (or at least, not like it does currently).
What makes special aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa is that it's a pattern that we can spot easily. I'm pretty sure that any other patterns would make us curious about whether it's important or not. It seems like something that is graspable.
63 comments
[ 3.4 ms ] story [ 131 ms ] threadEdit: A more recent (2017) study than Proudfoot 2011 offers the perspective that the process may be more tissue specific. From Tian B., Manley J.L. Alternative polyadenylation of mRNA precursors. Nat. Rev. Mol. Cell Biol. 2016; 18:18–30:
Alternative polyadenylation (APA) is an RNA-processing mechanism that generates distinct 3′ termini on mRNAs and other RNA polymerase II transcripts. It is widespread across all eukaryotic species and is recognized as a major mechanism of gene regulation. APA exhibits tissue specificity and is important for cell proliferation and differentiation. In this Review, we discuss the roles of APA in diverse cellular processes, including mRNA metabolism, protein diversification and protein localization, and more generally in gene regulation. We also discuss the molecular mechanisms underlying APA, such as variation in the concentration of core processing factors and RNA-binding proteins, as well as transcription-based regulation.
China is all about showing a good image to the rest of the world and their own population, and this outbreak goes in the face of that.
https://m.youtube.com/watch?v=lk5XkhUKMDM
The scale of the reaction and coverage seems entirely disconnected from its actual impact. Is there any point in wasting any resources at all in containing such a virus beyond just exercising your ability to do so?
A disease that makes you cough up blood, is highly mutable and can be spread for 2 weeks prior to experiencing symptoms is not to be dismissed as just the same as a flu.
https://en.wikipedia.org/wiki/Spanish_flu
https://www.cdc.gov/flu/weekly/index.htm
That's not mortality rate. You make it sound like 7% of those with flu will die. Instead it means that 7% of deaths are because of flu and pneumonia, which still seems high to me though
You cannot trust Chinese gov't numbers.
Your thermonuclear bomb example was pretty apt: It's actually pretty easy to find out how, it's hard to actually do it.
Also note that nuclear requires a certain amount of collection of radioactive material, kind of like gold but much more expensive. Viruses can just be drawn from anyone's blood stream / mucus.
People don't quite realize the catastrophic risk our over educated society can be as we learn more and more about the building blocks of our universe, intelligence, organic makeup or otherwise.
Vernor Vinge discusses it a bit in his latest novels.
What is the scientific requirement that the universe can not be easily meddled with by highly intelligent / knowledgeable agents? The human being did not evolve under circumstances where we had such capability.
Likely our best bet is to spread out to different planets where there would at least be some buffer.
Also DNA encoding proteins basically have a function epilogue and prologue.
Is it normal for there to be variation here? Do these repeated A sequences actually code for a protein or are they just a marker to let the ribosome know it's reached the end of the genome, and so the length of repeating As doesn't really matter past a certain point?
(I'm obviously not a biologist)
[0]https://www.ncbi.nlm.nih.gov/nuccore/MN908947
[1]https://www.ncbi.nlm.nih.gov/nuccore/MN985325
(also not a biologist, though I work with some)
Politicians sometimes ridicule basic research in an attempt to claim that government is irresponsible, and during recent elections it would have been a simple thing to ridicule the idea of studying "how many As are at the end of a viral genome" as an egregious waste of tax funds. Yet here we are.
Basic science without any known applications are how the really big discoveries come about. Sometimes we can guess that an area will be fruitful, but it's now always the case.
Next time somebody attempts to ridicule science as pointless, think back to why anybody might care about a strange pattern of nucleotides at the end of a virus.
My second thought is that the observation of an unnatural pattern would be really important. Naively an early hypothesis might be the something that looks unnatural is man made.
Your argument seems to imply a shopaholic hoarder isn’t wasting their lives, just so long as at least sometimes they actually use a random rubber band or a ‘70’s themed valentine card.
Pardon? That's awfully generous you're being with other peoples money. If that's the hit-rate, can you imagine what people could do with the money if it had not been taken from them in taxes? For starters you might simply ask, how many face masks could have been purchased.
Basic research should not be an ivory tower that is isolated from questions of cost vs. benefits.
Why would he expect aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to be less random than for example acatgagacgtctaatgttagacatgcatgac?
For aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to appear, it is either an amazing coincidence, or there must be some non-random mechanism that creates it.
Pardon my math.
Can we really consider any part of a genome random? I means your second example isn't part of it, so I guess it's "random" but if you compare any part, it would come from evolution and without this, the virus wouldn't survive most probably (or at least, not like it does currently).
What makes special aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa is that it's a pattern that we can spot easily. I'm pretty sure that any other patterns would make us curious about whether it's important or not. It seems like something that is graspable.