An overengineered solution to `sort | uniq -c` with 25x throughput (hist) (github.com)

118 points by noamteyssier ↗ HN
Was sitting around in meetings today and remembered an old shell script I had to count the number of unique lines in a file. Gave it a shot in rust and with a little bit of (over-engineering)™ I managed to get 25x throughput over the naive approach using coreutils as well as improve over some existing tools.

Some notes on the improvements:

1. using csv (serde) for writing leads to some big gains

2. arena allocation of incoming keys + storing references in the hashmap instead of storing owned values heavily reduced the number of allocations and improves cache efficiency (I'm guessing, I did not measure).

There are some regex functionalities and some table filtering built in as well.

happy hacking

48 comments

[ 3.4 ms ] story [ 84.2 ms ] thread
(comment deleted)
I don't [currently?] have a use case for this tool, but I love seeing existing tools made faster or more efficient.
Nice - thanks! I assume the non-naive implementations skip the sorting and instead hash the input lines?
yeah that's right - there are trade-offs in doing so as it can require much more memory. So like everything it's an application specific decision
The win here might be using HashMap to avoid having to sort all entries. Then sorting at the end instead. What's the ratio of duplicates in the benchmark input?

There is no text encoding processing, so this only works for single byte encodings. That probably speeds it up a little bit.

Depending on the size of the benchmark input, sort(1) may have done disk-based sorting. What's the size of the benchmark input?

Why does this test against sort | uniq | sort? It’s kind of weird to sort twice no?
`uniq -c` introduces a "count" at the beginning of the line, so what we are then sorting is on frequency of the unique terms in the output, not sorting the unique terms again (which indeed would be kindof nonsensical)
Small semantics nit: it is not overengineered, it is engineered. You wanted more throughput, the collection of coreutils tools was not designed for throughput but flexibility.

It is not difficult to construct scenarios where throughput matters but that IMHO that does not determine engineering vs overengineering. What matters is whether there are requirements that need to be met. Debating the requirements is possible but doesn't take away from whether a solution obtained with reasonable effort meets the spec. Overengineering is about unreasonable effort, which could lead to overshoot the requirements, not about unreasonable requirements.

> using csv (serde) for writing leads to some big gains

Could you explain that, if you have the time? Is that for writing the output lines? Is actual CSV functionality used? That crate says "Fast CSV parsing with support for serde", so I'm especially confused how that helps with writing.

Yeah I'm using it to serialize the output lines as a TSV. Rust's `println!` is notoriously slow and using `csv` to serialize the output is a nice way to boost throughput
Thanks. Nice find! Though it feels weird to have to use a csv crate for that. Ideally the `fast printing` part should be understood, and either used directly, or extracted as a separate, smaller crate.
This and similar tasks can be solved efficiently with clickhouse-local [1]. Example:

    ch --input-format LineAsString --query "SELECT line, count() AS c GROUP BY line ORDER BY c DESC" < data.txt
I've tested it and it is faster than both sort and this Rust code:

    time LC_ALL=C sort data.txt | uniq -c | sort -rn > /dev/null
    32 sec.

    time hist data.txt > /dev/null
    14 sec.

    time ch --input-format LineAsString --query "SELECT line, count() AS c GROUP BY line ORDER BY c DESC" < data.txt > /dev/null
    2.7 sec.
It is like a Swiss Army knife for data processing: it can solve various tasks, such as joining data from multiple files and data sources, processing various binary and text formats, converting between them, and accessing external databases.

[1] https://clickhouse.com/docs/operations/utilities/clickhouse-...

Note that by default sort command has a pretty low memory usage and spills to disk. You can improve the throughput quite a bit by increasing the allowed memory usage: --buffer-size=SIZE
I didn't know that - I've added in buffer size with a fairly large buffer to the benchmarks as well
> I am measuring the performance of equivalent cat <file> | sort | uniq -c | sort -n functionality.

It likely won’t matter much here, but invoking cat is unnecessary.

   sort <file> | uniq -c | sort -n
will do the job just fine. GNU’s sort also has a few flags controlling buffer size and parallelism. Those may matter more (see https://www.gnu.org/software/coreutils/manual/html_node/sort...)
(comment deleted)
Thanks for sharing!

You're right that the `cat` is unnecessary - and removing it actually had some marginal gains to the naive solution. I've updated the benchmarks to show this

Cheers

I created "unic" a number of years ago because I had need to get the unique lines from a giant file without losing the order they initially appeared. It achieves this using a Cuckoo Filter so it's pretty dang quick about it, faster than sorting a large file in memory for sure.

https://github.com/donatj/unic

(comment deleted)
I've actually added a benchmark for this specific task and added `unic` to it.

It may not be the most fair comparison because with these random fastqs I'm generating the vast majority of the input is unique so it could be overloading the cuckoo filter.

Looks like the impl uses a HashMap. I'd be curious about how a trie or some other specialized string data structure would compare here.
I think this could potentially really reduce the amount of memory required - especially in cases where there is a lot of repetitive prefixes.

Would be interesting to try this out

Neat!

Are there any tools that tolerate slight mismatches across lines while combining them (e.g., a timestamp, or only one text word changing)?

I attempted this with a vector DB, but the embeddings calculation for millions of lines is prohibitive, especially on CPU.

this looks very interesting and I'd love to add it to the benchmarking! I was interested in trying it but unfortunately got an installation error on my macbook where I'm running the benchmarks:

``` clang \ -g -ggdb -O3 \ -Wall -Wextra -Wpointer-arith \ -D_FORTIFY_SOURCE=2 -fPIE \ mmuniq.c \ -lm \ -Wl,-z,now -Wl,-z,relro \ -o mmuniq mmuniq.c:1:10: fatal error: 'byteswap.h' file not found 1 | #include <byteswap.h> | ^~~~~~~~~~~~ 1 error generated. make: ** [mmuniq] Error 1 ```

I use questions around this pipeline in interviews. As soon as people say they'd write a Python program to sort a file, they get rejected.

Arguably, this will result in a slower result in most cases, but the reason for the rejection is wasting developer time (not to mention time to test for correctness) to re-develop something that is already available in the OS.

(comment deleted)
People often use sort | uniq when they don't want to load a bunch of lines into memory. That's why it's slow. It uses files and allocates very little memory by default. The pros? You can sort hundreds of gigabytes of data.

This Rust implementation uses hashmap, if you have a lot of unique values, you will need a lot of RAM.

Yeah definitely, it's always a trade-off. I think in many cases where I use it especially the number of unique values is actually not crazy high (much less than the required RAM) and the number of lines is crazy high.

So in those settings I think it's absolutely worth it

I'm curious how much faster this is compared to the rust uutils coreutils ports of sort and uniq
Good question! I just added that comparison and the rust uutils coreutils port is significantly faster than the standard coreutils.
why no mention of awk ? awk '!a[$0]++'
I've added awk into the benchmarks also!
Also perl, should be faster than awk IIRC:

perl -ne 'print if ! $a{$_}++'

Storage, strings, sorting, counting, bioinformatics... I got nerd-sniped! Can't resist a shameless plug here :)

Looking at the code, there are a few things I would consider optimizing. I'd start by trying (my) StringZilla for hashing and sorting.

HashBrown collections under the hood use aHash, which is an excellent hash function, but on both short and long inputs, on new CPUs, StringZilla seems faster [0]:

                               short               long
  aHash::hash_one         1.23 GiB/s         8.61 GiB/s
  stringzilla::hash       1.84 GiB/s        11.38 GiB/s

A similar story with sorting strings. Inner loops of arbitrary length string comparisons often dominate such workloads. Doing it in a more Radix-style fashion can 4x your performance [1]:

                                                    short                  long
  std::sort_unstable_by_key           ~54.35 M compares/s    57.70 M compares/s
  stringzilla::argsort_permutation   ~213.73 M compares/s    74.64 M compares/s
Bear in mind that "compares/s" is a made-up metric here; in reality, I'm comparing from the duration.

[0] https://github.com/ashvardanian/StringWars?tab=readme-ov-fil...

[1] https://github.com/ashvardanian/StringWars?tab=readme-ov-fil...

Cool suggestions! I definitely would be interested in exploring other hash functions for this (and other binf works) so I'll definitely take a look at your stringzilla lib.
This reminds me of a program I wrote to do the same thing that wc -L does, except a lot faster. I had to run it on a corpus of data that was many gigabytes (terabytes) in size, far too big to fit in RAM. MIT license.

https://github.com/JoshRodd/mll

>I use nucgen to generate a random 100M line FASTQ file and pipe it into different tools to compare their throughput with hyperfine.

This is a strange benchmark [0] -- here is what this random FASTQ looks like:

  $ nucgen -n 100000000 -l 20 | head -n8
  
  >seq.0
  TGGGGTAAATTGACAGTTGG
  >seq.1
  CTTCTGCTTATCGCCATGGC
  >seq.2
  AGCCATCGATTATATAGACA
  >seq.3
  ATACCCTAGGAGCTTGCGCA
There are going to be very few [*] repeated strings in this 100M line file, since each >seq.X will be unique and there are roughly a trillion random 4-letter (ACGT) strings of length 20. So this is really assessing the performance of how well a hashtable can deal with reallocating after being overloaded.

I did not have enough RAM to run a 100M line benchmark, but the following simple `awk` command performed ~15x faster on a 10M line benchmark (using the same hyperfine setup) versus the naïve `sort | uniq -c`, which isn't bad for something that comes standard with every *nix system.

  awk '{ x[$0]++ } END { for(y in x) { print y, x[y] }}' <file> | sort -k2,2nr
[0] https://github.com/noamteyssier/hist-rs/blob/main/justfile

[*] Birthday problem math says about 250, for 50M strings sampled from a pool of ~1T.

The awk script is probably the fastest way to do this still, and it's faster if you use gawk or something similar rather than default awk. Most people also don't need ordering, so you can get away with only the awk part and you don't need the sort.
Totally agree it's a bit of weird benchmark - it was just the first thing that I thought of to generate a huge amount of lines to test throughput.

There are definitely other benchmarks that we could try as well to test other characteristics as well.

I've actually just added in this `awk` implementation you provided to the benchmarks well.

Cheers!

From a causal glance, isn't your code limited by the amount of available memory?

Which could be totally useful in itself, but not even close to what "sort" is doing.

Did you run sort with a buffer size larger than the data? Your specialized one-pass program is likely faster, but at least the numbers would mean something.

That said, I don't see what is over-engineered here. It's pretty straightforward and easy to read.

Yes you're right, it's not trying to do what `sort` is doing, it's trying to reproduce the output of `sort | uniq -c | sort -n` which is a more specialized but common task.

But you're right - it will be limited by RAM in a way the unix tools are not.

I did add a test with sort using a larger buffer size to the benchmarks as well.

It's shame that we normalized sorting twice for these cases.

Somebody, implement `uniq --global` switch already. Put it into your resume, it's a legitimate thing to brag about.