Fortunately, as healthcare is adopting a more consumer-centric paradigm, we get more options to schedule our medical visits digitally, using doctor appointment booking apps. In this blog, you’ll learn everything you need to know about doctor appointment app development.
https://steelkiwi.com/blog/how-to-build-a-doctor-appointment...
I need some clarification on "connect me to the internet", does that means I can watch Youtube videos by simply closing my eyes? I can search on Google with my thoughts?
Can I connect to my smart home so I can turn on the lights without saying a word?
Yes. And if you send ${Your bank balance} to 35hK24tcLEWcgZA4JxpöbkNkoAcJGqQP, I'll decrypt your memory on how to do that as well as all your other favourite memories.
Well, we can already use fMRI (maybe EEG as well) or PET scan to read the structure of people's thoughts. And researchers already have done BrainNet, A Multi-Person Brain-to-Brain Interface https://arxiv.org/abs/1809.08632
Science doesn't stay still. Given these it is no surprise that lay person think that this is possible.
well, you need to be a bit verbose I guess. Smile please, to like and frown to dislike.
If you are mad at a post then, you can just smash on the wall to show that reaction on person's FB wall :).
To be fair, I’m not sure I’d necessarily trust an “injectable” chip that’d be forever lost in my body, unremovable. Subcutaneous chips sound much more reasonable, especially if I can pay with my finger.
I don't think the question is aimed at the people who believe it's a trackable chip for Bill Gates to control your mind so much as the people who have no clue and know they have no clue but have heard some rumour vaccines have some connection with 5G which is bad, apparently, and want to understand whether it's true. Asking the question in a purposely silly way (is that really what Dave meant when he was talking about 5G?!) and then giving a techy-sounding answer that sounds like they're taking the concern seriously probably does reassure a lot of those people.
Well I guess we could have solved the rural Internet access problem at the same time as the pandemic but no. Big corporations and governments colluded to prevent that happening.
This is wild, like most I think this is a bit of comic relief, but honestly I think even answering this has added some legitimacy to the conspiracy nuts..
My only question is: can I choose my carrier? I’ll be damned if I’m forced to Sprint network!!! Oh, and another, what kind of plan I am getting, can I upgrade it and most importantly, is it paid for by taxes or will I receive the bills? Either way, I hope it’s tax deductible at least!
The good thing is that you get a free subscription to xCloud and you can play Xbox with your mind. If you get the extra vaccine you get also bluetooth support and you can use a joystick.
The cheaper ones mine bitcoin to subsidize the cost. How fast you gain immunity depends on the market rate of bitcoin and number of other people who have already been vaccinated and are skewing the hash rate.
On the one hand believing such things can be viewed as funny.
On the other hand it is a quiet serious issue.
While deployed to the Solomon Islands 15 years ago in a very remote location, the indigenous folks thought our helicopters were stealing all their gold and diamonds with giant vacuum cleaners in our helicopters.
Comically ridiculous, but they were serious as a heart attack.
And there were a few very aggressively and violently leveraged those mistaken beliefs.
So we had to respond with great care for their concerns rather than just disparaging them.
Doesn’t the same apply here?
Confirmation bias of internet searches and conformity bias of online fringe communities can lead to quite persistent and amplified opposition.
Actually, Australia will mostly be using the AstraZeneca vaccine, as an Australian manufacturer is licensed to produce it.
It's a good thing too that we have a domestic cabability, as other countries appear to be diverting previously promised doses elsewhere because of Australia's successful covid-19 control programs.
Note: happy to be corrected on any of this. Also, no judgement on the diverting of vaccine doses to more at risk populations, it seems sensible.
not really a practical thing (maybe some day, maybe never) - anything can be an antenna, not necessarily a good one, especially if you want some output actual power
There's a bigger problem at play here I think, and it's a variant of the CSI Effect.
It appears large swaths of people are getting knowledge of the sciences from popular entertainment. Of course they do impossible things all the time in fiction, but too many people seemingly can't distinguish the impossible things from the possible, so we end up with jurors that think "DNA" is the answer to every crime scene question, and people thinking "nanotech" can recreate magic.
I'm not sure how to fix this. The long term effects of devaluing knowledge scares me, though.
Smart people can't really understand dumb people. I'm somewhere in between, so I can see that anybody who actually believes this conspiracy theory would never read something like this, so it does not need to be explained.
“There is another reason bad ideas continue to live on, which is that people continue to talk about them.
Silence is death for any idea. An idea that is never spoken or written down dies with the person who conceived it. Ideas can only be remembered when they are repeated. They can only be believed when they are repeated.”
Does anyone else have a slight suspicion that this kind of stuff is promoted by authorities as a sort of "nudge"?
The goal, I think, is to emphasise the really wacky stuff so that anyone who might have more nuanced concerns about a vaccine (or anything else that differs from the "correct" narrative) gets lumped in with the crazies, and therefore shamed into keeping quiet.
The UK government, for example, has openly used psyops tactics on its own population for the duration of the pandemic, so I don't think it's too much of a reach to say that this could be another example of it.
> The perceived level of personal threat needs to be increased among those who are complacent, using hard-hitting emotional messaging.
From the minutes of SPI-B, the UK government's pandemic psyops group
Compulsory disclaimer that I'm not an anti-vaxxer, I will almost certainly take the vaccine as soon as it's offered to me. I'm just someone who thinks that a government using these fear based tactics on its own people is utterly shameful.
Polish govt site dedicated to vaccinations has Q&A section with one entry that was removed very fast - it was a question regarding microchips presence within formulas.
52 comments
[ 3.9 ms ] story [ 86.4 ms ] threadCan I connect to my smart home so I can turn on the lights without saying a word?
Reencrypting a memory is hard, right?
Science doesn't stay still. Given these it is no surprise that lay person think that this is possible.
Despite this bullshit, having so small internet connected chips would enable a lot new usages. Would be very interesting times.
A more helpful question would have been “Can I be spied/tracked after I’m vaccinated” or something along those lines.
The answer to which is obviously yes. You don't become invisible after taking the vaccines, for example.
"Doctor will I be able to play the piano after the operation?" "Yes" "Cool! I was never able to play it"
people who could believe that could believe anything
Yes. Sarcasm.
People believe it's a serious issue now which distracts from real issues.
Unless they're using the 'voltswagen' NTP server :P /lamejoke
The good thing is that you get a free subscription to xCloud and you can play Xbox with your mind. If you get the extra vaccine you get also bluetooth support and you can use a joystick.
On the other hand it is a quiet serious issue.
While deployed to the Solomon Islands 15 years ago in a very remote location, the indigenous folks thought our helicopters were stealing all their gold and diamonds with giant vacuum cleaners in our helicopters.
Comically ridiculous, but they were serious as a heart attack.
And there were a few very aggressively and violently leveraged those mistaken beliefs.
So we had to respond with great care for their concerns rather than just disparaging them.
Doesn’t the same apply here?
Confirmation bias of internet searches and conformity bias of online fringe communities can lead to quite persistent and amplified opposition.
and, a clone of haveibeenpwned will popup asking people to enter their brain scans to check if their brain was in the leaked dataset :)
Curiously, does this mean that the Pfizer vaccine is the only one Australia is using/has access to currently?
It's a good thing too that we have a domestic cabability, as other countries appear to be diverting previously promised doses elsewhere because of Australia's successful covid-19 control programs.
Note: happy to be corrected on any of this. Also, no judgement on the diverting of vaccine doses to more at risk populations, it seems sensible.
https://twitter.com/MoonbaseOtago/status/1370922507146985478
Can't the human body be used as an antenna?
Just saying, A fool can ask more questions than seven wise men can answer.
It appears large swaths of people are getting knowledge of the sciences from popular entertainment. Of course they do impossible things all the time in fiction, but too many people seemingly can't distinguish the impossible things from the possible, so we end up with jurors that think "DNA" is the answer to every crime scene question, and people thinking "nanotech" can recreate magic.
I'm not sure how to fix this. The long term effects of devaluing knowledge scares me, though.
Requirements:
* it's a "vaccine" in that it's something introduced into your body to prompt your body to make something else itself
* either you can access some information from the internet or you can be accessed in some way from the internet or both
* assume the patient has a smartphone with data access
Silence is death for any idea. An idea that is never spoken or written down dies with the person who conceived it. Ideas can only be remembered when they are repeated. They can only be believed when they are repeated.”
James Clear
The goal, I think, is to emphasise the really wacky stuff so that anyone who might have more nuanced concerns about a vaccine (or anything else that differs from the "correct" narrative) gets lumped in with the crazies, and therefore shamed into keeping quiet.
The UK government, for example, has openly used psyops tactics on its own population for the duration of the pandemic, so I don't think it's too much of a reach to say that this could be another example of it.
> The perceived level of personal threat needs to be increased among those who are complacent, using hard-hitting emotional messaging. From the minutes of SPI-B, the UK government's pandemic psyops group
https://evidencenotfear.com/how-sage-and-uk-media-created-fe...
Compulsory disclaimer that I'm not an anti-vaxxer, I will almost certainly take the vaccine as soon as it's offered to me. I'm just someone who thinks that a government using these fear based tactics on its own people is utterly shameful.
GCCAGTGAGTGAGTAAGTATATCCACTTACTTGTGTGTGTGTGTACTCGTC GGCTTGTGGGTGAGTGGGCACGCGGACTCGCATGCTTGCTGACTTGTGTGC AGGTGAGCATGCCAATTTGTGCATTGGCGAGGAGGTGTATGAGTGTATCGG GGTGCGTGGCAGCATGGAGAAAAAAAA