Good thing RFK pushed out the official overseeing this financing and the current administration is actively defunding the organizations that produced this.
Better to have more disabled or dead babies instead of science.
RFK runs HHS which oversees multiple grant, research, and review organizations in the federal government. This includes the NIH, which has been gutted of experts that don’t share the political ideology of the political arm of the executive and / or aren’t willing to say untruths in service of their political agenda. The news is replete with stories of experts being purged leaving entire areas of research unstaffed; from various cancers to HIV to genetic engineering. Of course the same is true in other areas, such as NOAA, EPA, FEMA, etc that will cause more acute harm. The research harms will play out over decades.
From a purely utilitarian perspective, funding research like this is not an effective use of dollars at the margin. How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking? How many people could we save if we stopped spending money we don't have to do things that the government isn't competent at allocating anyways?
That's not to say the research itself is not impressive nor important, but think critically about the fact that this money doesn't exist in a vacuum.
Given the admin’s propensity for cutting spending on research like this and other domestic interests while ratcheting up military spending I think that poster’s point stands.
It's not even that. Utilitarian premises still let a very broad set of perspective. A long term perspective on large humanity won't lead to same conclusion as what will be the most joy inducing experiences in the next 24h for the 1% wealthiest people in the world right now.
How do you know it's not effective? The cost per life saved is extremely high now, but this stuff gets better over time. How much did penicillin cost to produce originally?
And yet, the first patient treated with mass-produced penicillin used half the total supply, and the stuff was so rare that it was extracted from patients' urine for reuse.
> How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking?
How confident are you the answer isn't very close to zero? We've already curtailed smoking quite a bit in the past 30 years. At the level of an individual, it isn't any particular mystery how to stop obesity or to simply not drink, but population-level interventions attempting to get people to voluntarily behave differently for their own health historically haven't worked well in these specific domains. Throwing more money at the problem doesn't seem like it would obviously change that.
Also keep in mind that overeating and alcohol addiction have significant genetic components. Research into gene editing has the eventual potential to cure damn near any disease, including whatever pet causes you personally think are worth defeating.
>population-level interventions attempting to get people to voluntarily behave differently for their own health historically haven't worked well in these specific domains
Said like that it paints things like there are not far more resources spent on propagating the bad habits (as some ROI is expected from this by some actors), and any attempt to put a social health program in history always ended in major catastrophes.
I’ve thought about this recently as well and I don’t know if I have a fully developed view. What is the moral responsibility of all people to pay for medical research or operations that would affect a small number of people. Is it ethical to compel others to pay for the research deemed valuable by some, but not by others. Who is the arbiter of that research’s value?
I could say I believe the government should fund research into fixing people who think cilantro tastes like soap because for most of us it is delicious and promotes healthy diets. Should I be able to compel (tax) you to pay for that research?
Where that line is drawn will always be wrong to someone. How research is prioritized will always be wrong to someone. Is there an ethical way to determine the best use of collective resources and what portion of one’s property must be taken from them to fund that research.
I think that taxpayers should be advised that science is not a straightforward process like building a house from blueprints, and that a lot of important discoveries happen serendipitously.
The cilantro taste stuff does not sound absurd to me at all. In biology, there is no hard wall between banal stuff and critical stuff; they interact and fundamentally operate in the same environment under the same genetic and epigenetic rules. Sure, the research necessary for correcting cilantro-as-soap may be marginal, but there is a chance of discovering something significant along the way.
We should be more careful and also honest when communicating about science to taxpayers.
I think you may be operating under the assumption that the extremely expensive price tag will need to be repeated for each patient.
In reality, as this process becomes more mature it is going to become inexpensive.
The reduction in cost will almost certainly be similar to reduction in cost needed to sequence an individual's genome, which has fallen from tens of millions to hundreds of dollars.
The only catch is that we have to spend money to get there.
Another catch is that the nations who underwrite this research will turn millions in investments into trillions in dividends and the stingy or poor will be left in the cold.
Seeing that private enterprise is only good at taking publicly-funded work and patenting it, and that in the absence of public funding nothing ever gets invented, we should be all-in on this.
edit: it's apropos that you mentioned obesity because GLP-1 drugs are the direct, irrefutable, product of spending at government labs.
edit2: specifically, a single government scientist playing around with lizard saliva in the 1970s because he thought it was interesting.
I'm of accord with the Utopians of Ada Palmer's Too Like the Lightning:
When a Utopian dies, of anything, the cause is marked and not forgotten until solved. A fall? They rebuild the site to make it safe. A criminal? They do not rest until he is rendered harmless. An illness? It is researched until cured, regardless of the time, the cost, over generations if need be. A car crash? They create their separate system, slower, less efficient, costing hours, but which has never cost a single life. Even for suicide they track the cause, and so, patiently, blade by blade, disarm Death. Death, of course, has many weapons, and, if they have deprived him of a hundred million, he still has enough at hand to keep them mortal. For now.
>There's no evidence to support that gene therapy will ever be inexpensive.
My prediction is based on the number of efforts, too numerous to list here, being undertaken to develop lab equipment to automate the extremely labor-intensive workflow and the accumulation of vast libraries of CRISPR-Cas9 screens and dependency maps, the creation of which are also expensive and labor-intensive.
Yes, but the cures here aren't general. They're highly specific, and the rare conditions have a long tail- large numbers of different conditions, each with a very small population of affected individuals, and likely, the treatments will be somewhat customized for each type of disease.
See my comment above. Getting approval for rare diseases and expanding the indication to the common form of the disease is a well established strategy in pharma.
Also rare genetic diseases give insight into the underlying mechanisms and pathology of common sporadic diseases, which can be leveraged to develop new and better therapies.
Getting a new drug or therapy approved for a rare form of a disease and then expanding the indication to the common disease patient population is a well established strategy.
There are known DNA changes that would probably help all people with chronic diseases, but it's ethically more accepted to go for the more fatal diseases and cleaner cases first, like a rare mutation with a high fix rate.
That is not comparable at all. To save people from obesity, smoking and drinking, you don't need more resources on fundamental research. You need different education, and socio-economical programs, possibly even less funds on the overall: if no resources is spent anymore in promoting bad habits, you end up with more financial resources and a healthier population.
Instead if no resources is allocated on developing all the technical requirements to do such a thing, humanity ends up with less tools to heal itself, and that's it.
a) that statement above has nothing to do with RFK
b) the whole point of NIH and other government research funds is to pay for this sort of "not clearly an effective use of dollars" type of research that Pfizer et al won't touch. but you can look at a ton of future applications from this - lipid packaging, CRISPR methods, drug delivery, etc that had to be devised, and could conceivably be commercially viable if the methodology is perfected and the cost comes down.
The current administration doesn't care about kids. They only want you to not terminate a new kid from being born. That they care lots about. What happens after birth is not their concern. Also, I think when they say they want more babies, they want a specific subset of babies to increase.
> The current administration doesn't care about kids.
Of course they do. But untold amounts spent on very few kids could be spent elsewhere on many more. Federal budgets are a zero-sum game.
> Also, I think when they say they want more babies, they want a specific subset of babies to increase.
I've seen quite a few conservative commentators celebrate that the massively disproportionate levels of African-American abortion have been reduced, resulting in more African-American people being born, and zero bemoaning it. So maybe you're right.
>KJ has made medical history. The baby, now 9 ½ months old, became the first patient of any age to have a custom gene-editing treatment, according to his doctors.
This is _not_ the first human to be treated with a treatment under the wide umbrella of gene therapy based on their own edited genes. There probably is a more narrow first here but the technical details get lost in journalism which is a shame.
"Custom" in that this therapy was designed AFTER a specific patient showed a need, and then given to _that_ patient. In most every other context a particular class of disease is known, a drug designed, and then patients sought that have that disease that matches the purpose of the drug.
What's intriguing is not the 'custom' part, but the speed part (which permits it to be custom). Part of what makes CRISPR so powerful is that it can easily be 'adjusted' to work on different sequences based on a quick (DNA) string change - a day or two. Prior custom protein engineering would take minimum of months at full speed to 'adjust'.
That ease of manipulating DNA strings to enable rapid turnaround is similar to the difference between old-school protein based vaccines and the mRNA based vaccines. When you're manipulating 'source code' nucleic acid sequences you can move very quickly compared to manipulating the 'compiled' protein.
This is an AI-generated response, and is inaccurate.
That was one of the first cases of _germline_ gene editing using CRISPR - NOT "the first instance of gene editing." There have been quite a few other genetic editing tools that predate CRISPR, and there have been other edits using CRISPR that were not of the entire human's genome.
That's not gene editing, but you could call it a gene therapy - he's introducing new fragments of DNA/RNA into his cells which then just float around and cause the right enzyme get made. Sometimes called upregulation. This is different to actually editing the existing DNA in the cell.
I want to say, maybe it's better to say first human under proper IRB/regulatory compliance. Some rogue academic in China tried it a few years ago, if I recall, but with absolutely no oversight and he was pilloried. Also I don't think there is much details about what he actually did...
What the Chinese guy (He) did was completely different. He permanently altered the germline in embryos, which means that every cell in the resulting baby is transformed permanently with the change he made. The work he did violated a wide range of good practice (specifically, the change he made didn't actually work for the goal he desired, and he also ignored all the ethical advice around this experiment, and avoided getting the necessary approvals).
This research is instead a therapy used to treat an already born baby, and it doesn't modify all the cells in the body. Many cells in the body that are transformed by this technique will eventually die and be replaced by clones of stem cells which weren't transformed. I haven't read in detail about whether this therapy targets stem cells, and how long term effective the treatment will be- hepatocytes (liver cells) turn over constantly, so I would expect if the treatment did not affect the hepatocyte stem cells, it would only last ~months and the treatment would have to be repeated.
Do new liver cells always come from stem cells, not from dividing liver cells? Are those heppatocyte stem cells reside in the liver, or do they travel their via migration,.or blood, etc?
A quick search suggests that liver regen involves dividing mature liver cells to replace turnover. If so, I'd suspect that they'd continue to carry the.crispr edit forward.
I believe new liver cells come from both dividing mature hepatocytes, and hepatocyte stem cells. Cells can only divide a limited number of times, and they can't easily re-differentiate, so I would expect that while dividing mature hepatocytes would propagate the edit, they would eventually be replaced by cells that derived from stem cells that didn't get the edit.
The major difference is that was a hereditary change. So those changes could now diffuse throughout the species over time. As I recall it was a change that reduces vulnerability to HIV infection.
You complain about oversimplification, then in the same breath complain about "random political stuff" being included. How is that not hypocritical, at best? This medical breakthrough would literally have not been possible without "politics". Get your head out of the sand. No one should be able to escape learning how their politics affects them or the society they are a part of. And if you want to enjoy the benefits of that society, then you don't get to complain about being reminded of how those benefits were achieved.
Pandering to people's fragile political sensibilities is how the U.S. got to this point where millions of citizens voted against their own self-interest because they thought candidates running on anti-intellectual, anti-science platforms was worth the zero sum "win".
Enjoy your weekends, eight hour workdays, clean air, and clean water—whether you like that those were all political or not!
My experience is quite the opposite - I'm actually thinking about subscribing to the NYT (again) or The Atlantic (despite their higher cost) purely for the quality of their writing.
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed.
That is one of the most incredible things I have ever read.
Wouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
I think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
It's fundamentally different than a computer and arguably more complete.
The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem
"Bumps around until it hits" sounds like a set of magnets arranged to only mate up in a specific direction. Except we have four nucleotides rather than only two magnetic poles.
Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.
It was only in college, when I read Douglas Hofstadter’s Gödel, Escher, Bach, that I came to understand cells as recursively self-modifying programs. The language alone was evocative. It suggested that the embryo—DNA making RNA, RNA making protein, protein regulating the transcription of DNA into RNA—was like a small Lisp program, with macros begetting macros begetting macros, the source code containing within it all of the instructions required for life on Earth. Could anything more interesting be imagined?
Someone should have said this to me:
> Imagine a flashy spaceship lands in your backyard. The door opens and you are invited to investigate everything to see what you can learn. The technology is clearly millions of years beyond what we can make.
>
> This is biology.
–Bert Hubert, “Our Amazing Immune System”
This system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size).
True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.
If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete.
Cells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...)
Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.
Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.
One other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But, the RNA -> Protein equipment will just make protiens it without any problems.
Which, yeah, that's a miraculous discovery. And it was well worth the 2023 Nobel in Medicine.
Like, the whole system for gene editing in vivo that we've developed is just crazy little discovery after crazy little discovery. It's all sooooo freakin' cool.
I suppose a downside (depending on your perspective) of this is that it will make people who are genetically modified in this fashion trivial to detect.
That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports.
That's bad if your goals are to detect genetically modified people and discriminate against them.
I see a near future where the kind of people who loathe things like vaccines and genuinely believe that vaccines can spread illness to the non-vaccinated feel the same way about other things like genetic modification and use legal mechanisms to discriminate and persecute people who are genetically modified.
> it will make people who are genetically modified in this fashion trivial to detect.
I'm not totally sure. If I understand it correctly, the mRNA contains pseudouridine, and it makes the protein that will edit the DNA. The edited DNA should look like a normal one.
If you're going to make the comparison with vaccines, and if history is any indication, the more realistic worry would be the other way around (since that's where the money is): that genetic modifications will be mandated, and that those who object will be discriminated against.
[And no, I am not anti-vax, nor anti-gene-editing.]
It wouldn’t be crazy if I teleported 50 years in the future and heard someone tell me that not doing this is akin to child abuse. Obviously all suffering is relative, etc. etc., but it’s just interesting to imagine a world where the societal pressure to make a perfect child is high.
I don't know anything about gene editing, but my grandmother was a carrier of the BRCA mutation. It would have saved a lot of heartbreak in my family if that could have been detected and repaired. My aunt, mom, and brother (age 4) all died of cancer. I'm just glad that my mom didn't know she had the mutation and passed it on to her child.
Careful with qualifiers there. I genuinely believe that vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented. For example, it's why only the inactivated (aka "dead" virus) polio vaccine has been used in the US since 2000.
I'm not arguing about whether the risks of the attenuated virus outweigh the benefits. I think the data are very clear there. (Heh -- and I'm sure the vast majority of people will agree with that statement, even if they disagree on what the clear answer is....)
It's just that one shouldn't mock a belief without including the necessary qualifiers, as otherwise you're setting up an argument that can be invalidated by being shown to be factually incorrect.
As for genetic modification of humans, IMO there are a lot of very good reasons to be wary, most of them social. Fatal hereditary conditions are obviously an easy call. What about autism (not saying there's a genetic link there to use, just a what if)? Or other neurodivergence? Like being a troublemaker in class? Or voting for the party that doesn't control the medical incentive structure? Heck, let's stick with the fatal hereditary conditions, and say the editing does not affect germ cells. Is it ok if the human race gradually becomes dependent on gene editing to produce viable offspring? Or let's say it does extend to germ cells. The population with resources becomes genetically superior (eg in the sense of natural lifespan and lower medical costs) to those without, creating a solid scientific rationale for eugenics. Think of it as redlining carved into our blood.
I don't think discrimination against the genetically modified is the only potential problem here.
As humans, we'll deal with these problems the way we've dealt with everything else transformational. Namely: very, very badly.
I mean, I feel like autism is a terrible example here, it's not just some quirky personality trait, it's a reality people live with that runs the gamut from difficult to completely debilitating. Even the more mild forms of autism cause extreme difficulty in many aspects of life. If that was curable or preventable, that'd be great.
If it turns out some pathogen or chemical made me autistic, regardless of whether or not I could be cured as an adult, I'd have certainly preferred to live the reality where I had been as a child.
Sure, the purpose was to illustrate a slippery slope, and curing autism is meant to be more obviously good than abolishing all forms of neurodivergence but less obviously good than fixing fatal hereditary diseases.
I'm not going to claim that I know the perfect place to draw the line.
I think a better reason autism is a bad example is that part of its definition is that it is a consequence of fundamental brain structure and development (differentiating it from other psychological disorders which are acquired and more malleable). These aren't things you will "undo" with some gene edits. The whole brain has developed in a different way. Short of re-growing them a new brain you aren't going to change that (assuming you wanted to).
I think scientists have believed for a while that any type of “autism cure” would need to be extremely early intervention for maximum effectiveness for exactly this reason. I remember speaking with a team that was studying detection of autism in the womb for this exact reason.
> vaccines can spread illness to the non-vaccinated, since it has happened many times and is well-documented
Nothing in medicine is certain. Nearly any medical treatment has a small chance it could kill you. There’s a small, but non-zero chance of a lethal infection even if they injected you with saline, odds that rise dramatically in less than sanitary conditions.
Ironically the use of the attenuated oral vaccine for polio was because of the risk of infection in places where the availability of sterile syringes was hard to guarantee. It’s all about the relative odds.
At one time organ transplants were considered an ethical grey area (perhaps they still are by some), but I think most people now would consider it better to save lives in such a manner when it only brings help to those who need it and it's possible to, compared to the alternative. Having the capability may mean that things like organ theft now exist, but the benefits around the world outweigh the nastiness that has always come as part of human nature.
I agree that organ transplants are a net positive, and in fact are far less susceptible to unintended consequences (there's a pretty low limit to the number of organs and operations involved, for one.)
I also think that gene repair is a net positive. I would just like us to, for once, look ahead and foresee some of the foreseeable consequences and act to mitigate them before the bulk of the damage is done.
I don't think it's necessary to slow the development; gene therapy is too desperately needed, and slowing it down so that we can prepare is not going to cause us to prepare.
I'm more concerned about the possible negative unintended consequences of making it available to everyone first. Genetic modification is well-explored Pandora's Box in science fiction and present humanity seems so ill-equipped in collective philosophy and reason to handle a paradigm shift of that magnitude.
Not OP, but presumably it's because it could cement a permanent divide between classes. We still have quite a bit of upward mobility in the US, but health is a tremendous predictor of future outcomes, so gating that to the rich is dangerous to the stability of society in that way.
This seems like more of an issue with accessibility of the treatment than the treatment itself
If we could make most children smart, productive, ambitious, courteous, civil, conscientious, honorable, strong... the value to society is probably high enough to justify covering it for almost anyone.
The society already can invest a lot (through public education) to “make most children smart, productive, ambitious …”.
Somehow society (or indeed parts of it) decided to use it as a tool of further segregation rather than overall prosperity. I’m afraid same might apply to this.
We "invest" more than almost anyone. 38% higher than the OECD average. I don't find discussions about throwing more money at the problem to be constructive so much as a way to ignore other issues at play.
I don't really see how this affects e.g. what I do for my children. I will absolutely be turning them into the closest to superhuman the current state of treatments lets me, traveling internationally if I need to. If someone else decides to segregate access to treatment, that is a separate, wrong act that will not hold me back from giving my children every advantage possible.
(Yes, I understand this is a positional arms race, but 1. that doesn't change the individually-optimal outcome, and 2. that doesn't change that society net benefits from it.)
I don't mean to invest as to spend more money, rather to spend money better and in a more equal way. While USA spends a lot of money on education I don't think it translates in better education on average. Even if this was beneficial for the society in general.
I am, afraid, that this kind of genome modification will further increase divide in a society and turn social lifts off even more. I.e. it's not gonna be your kid to get "improve" brain genes first, and later your kid wouldn't get a chance to get it ever again for their children.
Just to be clear I'm not against of the progress, this thing is fascinating and really shows how awesome humans are. And I get why you'll get it if possible for your kid. I'm just not sure its benefits for the society mean it's gonna be anyhow affordable for regular people.
You will have a really hard time convincing Americans to keep paying high taxes while funding is pulled from their children’s schools and redistributed to inner cities and ruralia. My observations suggest the problem for the latter isn’t financial.
I'm explaining that gene modification will not be considered illegal or bad because the rich will have a vested interest in it being legal. This is a reply to GP saying:
> use legal mechanisms to discriminate and persecute people who are genetically modified
I believe there is no way this will happen, because legal mechanisms are driven by the whims of the rich, and they will want gene editing to be legal. So there will beno legal mechanisms to discriminate against those who have been edited.
RNA is a byproduct, not a "source of truth" in technical terms. The DNA is. DNA is converted to RNA and then executed and then discarded, per my understanding. The DNA is still AGCT.
Not under the current way we do things, I don't imagine.
So the real trick here isn't the mRNA, it's the nanobubbles. Basically, you're putting these bits of mRNA into these little fat bubbles and then injecting those into the blood. Making those bubble shelf stable is really hard, hence the issues with temperature and the covid vaccine. To then make those little fat bubbles stable-ish in the blood is also a really hard thing to do. They have to get to the right places (in this baby's case, the liver) and then degrade there, drop off the mRNA, and not mess up other tissues all that much. Like, it's not terrible to make these micelles degrade in vivo, but to have them do that and not degrade in the tubes, ... wow... that is really difficult. There's a reason that Moderna is so highly valued, and it's these bubbles.
To try to then put these in a weapon that could do this though the airways would be, like, nearly impossible. Like, as in I think the second law of thermodynamics, let alone biology, and then simple industrial countermeasure like a N95 respirator, yeah, I think all of that makes it pretty much impossible to weaponize.
(Hedging my bets here: I don't know if they had to do all that with this baby, as you can kinda go from lab to baby really fast, since it's such a special case. But for mRNA based vaccines and cancer treatments, you have to deal with the shelf stable issue)
(Also, other bio people, yes, I am trying to explain to laymen here. Please chime in and tell me how I'm wrong here)
Something that a lot of people are unaware of is that US Military is allowed to do this. I forget the exact EO, but it was signed by Clinton and is in the 12333 chain of EOs. Mostly, this is used for the Anthrax vaccine. But, it does give clearance to do other forms of medical experimentation on warfighters.
No, really, I am serious here. This is true. I may have the details a bit off, so sorry there, but they can and do preform medical experiments on people without their consent. Now, to be fair, France does this too. They do sham surgeries over there. Non-consenting human medical experimentation is quite the rabbit-hole.
So, I can kinda see in the next 10 years, certainly the next 50, a routine shot given to warfighters to help them with things like blood loss, or vitamin C production, or fast twitch muscles, or whatever. The legal framework is already there and has been for a while, it's just an efficacy issue, honestly.
I’m not sure of by “they just suck” you meant to imply that they’re ineffective. If that’s the case, I strongly disagree. They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific. Nobody wants it used on them, so nobody uses it on anyone else.
I cannot imagine a more effective weapon than an invisible gas that melts you alive, and there are MANY chemical and bio examples of these types of weapons.
The ceiling for the destruction caused by biological weapons is far greater than chemical weapons. There is no chemical weapon that can hijack the victim to make more of it.
>> They are not used because somehow all countries pretty much agreed they’re way TOO effective and horrific
That’s the story but it doesn’t hold up. Chemical weapons were used as recently as the Syrian civil war. I also think if they were really effective in modern warfare, Russia would have long ago deployed them in Ukraine.
What do you mean “if they were really effective”? We still hand out CBRN gear and train in how to put necessary parts on in seconds, because that’s often how little time you get before you’re permanently incapacitated. Mustard gas alone should prove this, and that’s an OLD chemical weapon.
Nowadays we have riot control agents that can be tailored to demographics, react more violently in the presence of sweat, or contain psychoactive ingredients. Nanoparticle dispersion bypasses common gas masks and clothing protection. Even if you’re completely geared up, they can be engineered to last on surfaces for a long time, or react only in the presence of certain triggers. Imagine thinking you’re safe until someone turns on a certain light bulb and you cook inside your protective gear because you were actually exposed 12 hours earlier in an undetectable manner.
I'd encourage you to read the article. Chemical weapons are effectively useless against a well-trained "modern system" army. Part of that is the chemical warfare equipment and vehicles, but mostly it's cover-and-concealment. If you can actually find the enemy, it's much faster and simpler to use the other vastly destructive munitions that modern militaries have.
I did, and it’s really not very convincing at all. It uses an example where a terror group in Japan was able to injure thousands of people with a chemical attack, and act as if this is… not a particularly effective outcome?
Additionally, that “if you can find them” is doing some pretty heavy lifting. The range of explosives and kinetics is hilariously low, and the actual percentage of your military with the level of mobility he seems to be referring to is infinitesimal.
This argument more correctly explains why chemical weapons aren’t a great defense against precision strike groups. It also doesn’t get into detail with concepts like dropping a bomb right in the middle of a firefight knowing it literally cannot harm your own troops, short of the physical metal accidentally falling on one of your own troops.
>I did, and it’s really not very convincing at all. It uses an example where a terror group in Japan was able to injure thousands of people with a chemical attack, and act as if this is… not a particularly effective outcome?
Yes, it isn't effective outcome in terms of meeting their objective
> It also doesn’t get into detail with concepts like dropping a bomb right in the middle of a firefight knowing it literally cannot harm your own troops
That's a video games logic, it doesn't work like that in practice. Even civil grade riot control tear gas grenade is pretty traumatic because it still explodes to disperse the gas (source : implied first hand knowledge). That and warfare is messy, which means half the time half the protective gear will be destroyed from the usual exploding and shooting happening, gas gets carried away by the wind in a random direction, etc, etc.
No, it’s science. There are about a million ways to protect your own troops if that’s actually what you want to do.
It feels like you’re arguing against the idea of chemical weapons from the 1940s, rather than nearly a century later.
You don’t need protective gear. You can create sprays, lotions, inhalants, and other countermeasures that don’t stop working the second a piece of cloth rips. Shit, You could make a biological agent that avoids a DNA marker created with an mRNA vaccine. Likely not nearly as fast, but perfectly lethal.
Modern chemical weapons and biological weapons are absolutely incomparable to their Vietnam counterparts.
The reason that the body doesn't alarm as much to Pseudouridine, is that it's not a 'natural' RNA base. Meaning that, for the most part, nature really never uses it and so we haven't evolved to look out for it. Nature uses Uridine and so immune systems have evolved to look out for random bits of RNA in the body that use it and then clean that all up.
It's like if you're looking to clean up legos in you house with a romba that only cleans up legos. And all of a sudden it finds a duplo. It's going to take a hot second to figure out what to do with the duplo. And in that time, you can sneak by and build a duplo fort. (Look, I know this analogy is bad, but it's the best I can come up with on the fly, sorry. If anyone else wnats to come up with a better one, please do!).
The Pseudouridine is used up and degraded very quickly inside the cell, minutes at the very very longest, more like microseconds. It's just part of a messenger (the 'm' in 'mRNA') to tell the cell to do things.
You might see mRNA gene editing in factory farms, but it would just be easier to do germline editing instead and skip spraying animals, plants, and fungi. Why waste the equipment, right?
As I understand it, there is nothing in nature that can create it, so the mRNA can never be accidentally replicated. It’s a safety mechanism that prevents escape.
I remember from a few few years back that the lipid coating may have caused problems for the liver, when treating people for diseases that needed to target a lot of tissue, such as muscle disorders. Is that still the case?
You remember correctly. Moderna had a lot of problems with their drug trials due to the lipid nanoparticles they were using to transport mRNA. They were toxic to the liver upon repeat dosings. Unfortunately, it appears they never found a fix for the problem. Instead they gave up and found a "business solution" by pivoting from drugs to the (at the time) less profitable vaccines, on the grounds that vaccines are something you only need to take once so the toxicity issue could be dodged. Doh. That was in 2017.
By the time COVID vaccines came around a few years later there was no evidence they had fixed the problems with lipid nanoparticle delivery. I looked for such evidence extensively at the time, for example, announcements by Moderna of breakthroughs or trials of new drugs. Today the situation seems not much different. Note that Moderna's wikipedia article has a section on "rare disease therapeutics" but it's literally empty:
Because of their failure to progress beyond COVID vaccines Moderna's share price got slaughtered, falling from a peak of ~$450 to ~$25 today.
I don't know if other companies were able to find breakthroughs here, after COVID I stopped following the topic. Unfortunately, although mRNA tech has great potential, when normal safety standards were reimposed it appears that Moderna went back to being unable to make anything safe enough to launch.
What was the success of other means, such as sugars and proteins? Something like glycocalyx or polysaccharide capsules? Or HIV like deployment gp41/gp120?
It sure would be nice to see the data on length of time between doses to prevent toxicity. The fact they deleted all of that data sure is suspicious and incredibly worrying.
Toxicity depends on dose. COVID vaccines just need micrograms of material to induce an immune response, I imagine it takes more than that to edit the genes of a large organ.
There have sadly been cases where the vaccines did perform unintended gene editing. It shows up as people whose bodies are still producing spike protein months or years after vaccination.
The Yale LISTEN study found such people for example. Studies on post vaccination heart damage also found free spike protein in the blood of those affected, i.e. the body had turned off the immune response to the spike due to persistent internal production. The most likely way this happened is understood if you dig into it.
Do you have a citation for this? The only relevant study I saw on the LISTEN website was a preprint of a study showing data on self-reported post-vaccine symptoms, but didn’t really talk about causes or gene edits (Krumholz et al. 2023).
It did discuss causes to some surface level: continuous spike protein production, T-cell exhaustion and Epstein-Barr reactivation. And they're investigating post-vaccine syndrome so the root cause there would be clear, as the study authors discussed in the LISTEN press release.
It's easy to find papers discussing the problem, just search Google Scholar. Example:
"Of the S1 positive post-vaccination patients, we demonstrated by liquid chromatography/ mass spectrometry that these CD16+ cells from post-vaccination patients from all 4 vaccine manufacturers contained S1, S1 mutant and S2 peptide sequences"
They can tell the difference between vaccine spike and virus spike as the vaccine spike was modified for stability. The exact pathway is speculated to have been DNA contamination due to manufacturing process defects. Sequencing of vaccine vials has shown far higher levels of DNA contamination than is considered safe, and the lipids would bring DNA into the cells just as well as they do mRNA making the safe levels much lower still.
> A significant limitation of this study was the lack of approved testing to 100% rule out previous
infection and it is possible the persistent S1 protein detected in the CD16+ monocytes of some of
the patients in this study is from SARS-CoV-2 and not from the vaccine. There also exists the
possibility that some of these new-onset symptoms post-COVID vaccination are unrelated to the
vaccines. The data from this study also cannot make any inferences on epidemiology and
prevalence for persistent post-vaccine symptoms. Thus, further studies and research need to be
done to understand the risk factors, likelihood and prevalence of these symptoms.
What do you mean? Is mRNA not used to produce the enzyme that these comments mentioned?
I don't think they were saying mRNA is gene editing itself. Just commenting on a modified mRNA helping the process compared to normal mRNA.
Might be misunderstanding though so correct me if I am
I dunno, I think they are being sloppy and conflating things. We can induce manufacture of proteins and can design proteins that carry out gene editing, so we can stack that knowledge together to induce cells to manufacture proteins that carry out gene edits, but it's the payload that is the gene editing, not the instruction to make the protein.
Given the merry movement to call the COVID vaccines gene editing, it rankles.
Hey, yeah, I'm not the most up to date on the current methods. Most of my knowhow is a bit out of date here. So thanks for piping up to correct things.
Do you know of any good resources that I can use to get up to speed on the exact methods they used for the baby?
My understanding, outdated as it is, is that we're using the mRNA to go in and create CRISPR-CAS9 slicers/dicers and additionally to that, the correct genes (not mRNA) to get stitched in. I would love to know more about how I am wrong here, as I am sure I'm not even close to really understanding it.
I think you're replying to someone edgelord about covid who got confused about some mrna statement and then back pedalled re-affirming what the article was about.
I would be surprised if viruses using U instead of T didn't already exist. After all, don't all viruses work by doing gene editing in vivo, except just localized to one cell?
EDIT: well, I suppose the question is whether cells of living beings could produce the U required for the viruses. But if not, then a wild virus using U instead of T to bypass our immunity also would not be a threat for that very reason.
It’s not the use of Uracil/Urimidine that bypasses the immune system. RNA uses Uracil instead of thymine in all organisms afaik, and RNA viruses certainly exist. It’s pseudouridine that’s the magic stuff.
It would allow a synthetic virus to get a foothold in your cells more easily, but our cells don't make Pseudouridine naturally which throws a big wrench in the ability of a virus to copy itself. And without replication you don't have a serious infection.
Yeah, I mention this in some other comments that got greyed out.
Basically, the real deal technology here is the lipid bubbles that deliver the payloads to the right cells, not the base modification. You can go look at them, and a lot of other comments in this thread for more info on that tech.
TLDR: No way that anyone can bypass anything. These lipid bubbles are a miracle that they work at all; they're so unstable, it boggles the mind we can even use them to begin with. Doing any large scale DNA editing on an unsuspecting population would be so insanely expensive and difficult, I certain moving to the Moon would be cheaper.
Gene therapies are pretty incredible. Some of them are still making a button-hole with a machete, but that's relative to the previous medical intervention of a button-hole with a tank's main gun.
One of the treatments for sickle-cell involves switching off the gene that makes the malfunctioning red blood cells, but of course that's not sufficient; you'd stop making red blood cells completely and you'd die. So it's combined with a modification that switches on a gene that all humans express pre-birth that causes your body to make "super-blood": red blood cells with significantly more binding points for oxygen. This is necessary because a fetus gets oxygen from its mother's blood, so the increased binding affinity is useful for pulling the oxygen towards the fetus at the placental interface. After birth, expression of that gene is disabled and regular RBC genes switch on.
So the therapy doesn't "fix" sickle RBCs; it disables the body's ability to make them and re-enables fetal RBCs! I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant, I imagine increased-affinity RBC could help for athletics... But I also imagine it requires more iron to generate them so has dietary impact).
High affinity RBCs would actually be a disadvantage for athletics. You actually don't need very high affinity to pick up oxygen from the lungs -- your lungs are comparatively extremely high in oxygen. What matters more is being able to drop the oxygen off in peripheral tissues. Higher affinity means that it's harder to actually deliver the oxygen, which is why we evolutionarily developed the switch away from fetal hemoglobin.
I thought the evolutionary impetus for fetal hemoglobin was because it greatly increases the efficiency of fetal oxygen uptake across the placental interface?
From shadowgovt:
> I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant
This was exactly the question that popped into my mind when I read about switching from normal adult RBCs to fetal RBCs: does this therapy reduce the likelihood of carrying a baby to term?
Yes, that is true. I phrased that badly -- it's more that we didn't take the evolutionary branch where we retain the fetal hemoglobin because it is maladaptive in adults.
I have natural persistence of fetal hemoglobin which counteracts my inherited thalassemia trait.
No problems really..never knew I had it until I was told I had thalassemia trait as part of genetic testing. My hemoglobin panel shows fetal hemoglobin.
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene.
This isnt entirely unlike the method mRNA vaccines use. Through some clever biochemistry, mRNA vaccines get bits of code into cells where the cell's built in code compilers manufacture proteins that induce immunity.
We have developed software patches for our biology.
I know someone well who works in this space, personalized gene therapy as cancer treatment.
> until it finds the exact DNA letter that needs to be changed.
This pine is disingenuous (at best). There is no way of guaranteeing where the DNA is inserted. It is designed to only slot into a very specific portion of the DNA but they don't have a way to control that precisely, the accuracy is high but "exact DNA letter" is skipping over a few pretty important details.
To be clear I'm not saying it is ineffective or unsafe, only that the claim made is marketing speak and not actually true.
The approach they used which is base editing doesn’t actually insert or remove DNA, it actually uses an enzyme to convert one base to another, which is much safer as this doesn’t require a double strand break in DNA: https://blog.addgene.org/single-base-editing-with-crispr
That is interesting, I didn't catch the difference my first time through the article.
I do still question their claim of 100% precise results though. At least based on that high level description I can definitely see it being safer, but I question any scientific claim that is an absolute.
Specific to the editing vs insertion mechanism, I question how it doesn't run into similar constraints where the mechanics of targeting exact portions of the DNA can occasionally miss or impact the wrong segment of DNA entirely.
I haven't dug as deeply down the base pair conversion though, so I could absolutely be wrong!
I had heard about CRISPR a while back but most reporting on it kind of hand waved over the mechanisms of how it actually accomplishes its work. What these researchers have figured out to make this work absolutely blows my mind.
It can make “bad edits” eg off target effects. But in this case there were, as far as is known, none. It’s aided that this was a single nucleotide defect.
They specifically tested for off target edits in the mouse study and found no harmful edits (and very rare off target ones). That plus the specific targeting of the liver cells (no germ line effect expected), makes this a low risk approach and certainly better than doing nothing.
How does it know how to gps around? From what I know everything down there is a chemical reaction with some minimal physical motion, but how do you program it to know where to change and what and how.
An interesting part of the study was determining what a clinical dose _should_ be. You need enough to edit enough liver cells. But don’t really want to completely overdo it to limit potentially negative side effects. Seems like they got it right enough here, with the first dose having some effect and the subsequent dose having more.
You need billions to cover multiple cells, you don't need many for a cell.
The counterintuitive part is how fast thermal motion is relative to the size of dna.
In body temperature water, the thermal velocity of water molecules jostling around everything is ~600m/s. The nucleus of a human cell is ~6µm in diameter. That is, your average water molecule bounces around at a speed that makes it move from one end of the nucleus to another roughly 100 million times per second.
Larger molecules move more slowly, but they still zip around fast enough that nothing needs to "seek" to a specific position in a cell to get there, everything will touch everything just from thermal random walk in a very short time. So how biology works is that inside the cell there might be just one messenger, which will have to hit a specific piece of dna just right in order to do anything, but that's still nearly instantaneous from our perspective.
Well its more like search and replace, where you cross your fingers that it only replaces the words you are trying replace without impacting the rest of the text in the document.
Essentially you can design an rna molecular that contains a 20 nucleotide long sequence that can target your region of interest, with the caveat that there is a standard recognition sequence proximal to your sequence of interest (PAM sequence)
It doesn’t know anything about where it “needs” to go. One of the weirder and more unintuitive things about molecular biology is just how fast everything moves inside a cell. The CRISPR molecule diffuses from one side of the nucleus to the other in a couple seconds and probably bumps into the entirety of the genome in a matter of minutes or hours. It’s very, very crowded inside cells, proteins and DNA and metabolites are constantly bumping into each other and are tumbling around at frankly incomprehensible rates. So, nothing needs to “know” where it needs to go, it simply gets pushed and jostled around until arrives there and then the attraction between the CRISPR’s RNA and the DNA takes over
This sounds so much like "simulated annealing" with reactive components and almost no lack of energy in the system. Various energies/reactions occur, which unlock or lock out other possible reactions.
Cue the book "The Code Breaker" [0]. I read it a long time ago and such an incredible book and journey by Jennifer Doudna and Emmanuel Charpentier. Do check it out
A chemist friend of mine did his thesis on lipid vesicles, and I remember my mind being blown when he told me these are modelled as a liquid on the 2D plane of the membrane, but as a solid on the 1D orthogonal direction because the energy to swap two lipid molecules side by side is incredibly low (because it makes barely any difference), while the energy to swap them orthogonally to the membrane is much larger (because they would point in the wrong direction).
Once the gene has been edited, things will work. But at some point that cell will die. Why would the replacement cell also have the edit? The DNA in the rest of the body's cells will still not be correct.
> The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services.
Bear in mind that they intentionally choose something that was soluble - ie the easiest thing possible. So it's doesn't mean everything is now solvable.
For example it's no coincidence this is a liver disease as basically almost everything you inject in the bloodstream ends up concentrating in the liver by default - if you needed to target another organ with your LNP it would be much harder. Most of the time people are trying to stop stuff accumulating in the liver!
The liver has other special properties that are helpful as well.
Having said all that - it is still a massive achievement.
> That is one of the most incredible things I have ever read.
Biology is incredible - and you can do incredible things if you leverage it.
You should have seen the homebrew guy’s talk on DIY CRISPR where he injected himself on stage. And that was years ago. Incredible times for incredible work.
NYT isn’t super specific here, but they made it sound like the disease treated is liver related. My understanding is that the liver is a good place to start with CRISPR-type gene treatments, in that the liver normally deals with anomalous shit in your bloodstream, say, like CRISPR type edits. So anywhere outside the liver is going to be significantly harder to get really broad uptake of gene edits.
It’s crazy encouraging that this worked out for this kid, and I’m somewhat shocked this treatment was approved in the US - I don’t think of us as very aggressive in areas like this. But to me, really hopeful and interesting.
I hate to break it to you, but it will be substantially more difficult to target other organ systems. The liver is uniquely easy to target with our current vectors.
Right off the bat, the liver receives roughly a quarter of all cardiac output, either directly or second hand from the digestive organs. Additionally, the liver has a fenestrated endothelium which, while not completely unique in the body, uniquely allows molecules like lipid nanoparticles (LNPs) to access liver cells. Finally, the liver is the site of most lipoprotein processing, and LNPs can be designed to take advantage of the existing pathways to get the gene editing mRNA into the hepatocytes. All this is to say that if you have a genetic condition that primarily effects the liver, there's a lot more hope for treatment in the near term than for others.
Good lecture on the difficulties of finding appropriate platforms for delivering gene therapies to cells for anyone interested [1]
No they were not. A vaccine triggers an immune response, not a functional change.
mRNA vaccines are highly localized: you get a sore arm because most of it only gets taken up by muscle cells around the injection site, which spend some time producing the antigen and triggering a primary immune response (the inflammation aka the sore arm).
As for being localized it's true however after vaccine dose S proteins have been detected also in remote locations in the body because you can't make something 100% localized.
If you had an infusion that doesn't trigger immune system you could just increase the dose significantly, put it in the blood and most likely it would have reached all cells that blood reaches.
Last I heard those gene editing things lead to so called of-target edits, so they were basically corrupting random dna. Now in this case the baby would have died without this treatment so clearly benefits outweight the risks. But even then they probably want to have the dose be as low as possible.
What I find interesting about the covid mRNA vaccine is I remember being sick in March 2020 and I can't remember being sick since.
I can remember getting a sniffle at night and waking up fine the next morning a few times.
I think I had two doses of covid mRNA vaccine.
I have actually forgot what it is like to be sick. It almost feels like the covid vaccine gave me some kind of super immunity. I never get the flu shot either. I have not had the flu in 5 years for sure.
People born with this lack the enzyme CPS1, which screws up the urea cycle and causes a build up of ammonia. Ammonia build up is bad for your nervous system.
You are right, current CRISPR systems tends to accumulate in the liver. Most CRISPR companies have shifted their focus to the liver over time because it's easiest to deliver there. Most viruses people use to target other organs are not large enough to carry CRISPR and lipid nanoparticles with CRISPR seem to like ending up in the liver and are hard to deliver at dose to hit other organ systems. It has been one of the big struggles of CRISPR companies. That being said, this is a huge deal and very encouraging.
As to the FDA stance, it tends to be more willing to go ahead with compassionate uses like this when it's clearly life or death.[1]
I think it was here a few years ago that I read a comment saying that sick children will be the Trojan horse for normalizing gene editing of humans, because who could say no to sick children, right? Well, guess it's here now, so how long utill the eugenics wars start?
A baby Hitler gaurantees a future with a grown up Hitler. Killing the baby eliminates that future.
There could be other babies that can also grow up to be future Hitlers. So let's say 4 such babies exist. By killing one I eliminated 1/4 for futures with Grown up Hitlers that exist.
This whole thread is getting flagged. Likely by an irrational parent who can't even compute natural selection, babe, and Hitler all in a single paragraph.
I think part of the problem is that “really good” and “really bad” are not universally accepted norms for any given ethical question. What you’re seeing is your own value system assumptions being checked.
It’s perfectly reasonable to say that while a technology has the propensity to be used for evil, it also has positive applications and that the real benefit now outweighs the potential downside in a hypothetical future.
Otherwise you will go down a rabbit hole at the bottom of which lies a future where we all just kinda dig in the dirt with our hands until we die because every technological innovation can be used in a variety of ways.
Like, it’s silly to me that I can’t bring a 1.5” blade keychain utility knife on a flight, and then they hand me a metal butter knife in first class. I could do way more damage with that. But they allow the butter knife because the utility has shown to far outweigh the potential downside that hasn’t manifested.
> I will slaughter a baby if I know for a fact that baby will grow up to be the next Hitler
This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
>This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
It's true. But things like this should be easy to say right? Like we may not be able to act logically. But we should be able to think logically, communicate logically and show that we are aware of what is logical.
My post got flagged meaning a lot of people can't separate the two things. So for example I may not be able to kill the baby in reality, but I can at least see how irrational I am.
The person who flagged me likely not only can't kill the baby. He has to construct an artificial reality to justify why he can't kill the baby and why his decision must be rational.
I think things like that should be easy to say, if by that you mean censorship. Sure. But talk is cheap. And there are gradations of reality.
It would maybe be easier for a 15-25 y.o. to kill a baby they don't know and whose parents/family they don't know, and maybe even easier if they don't speak their language or look like them. Of course, the baby wouldn't be the only one you'd have to kill, most likely.
I submit that it would be very very different if you found out that your 4 year old child was going to go on to be the next Hitler. For a "normal" person, I think they would go to the ends of the earth to try to shape them into the kind of person that wouldn't do it. I think very few people would coldly calculate "welp, guess I gotta execute this adorable little child I've grown so attached to" as it looks up at them saying "I love you so much forever, mommy/daddy" with their little doe eyes.
(ETA: it also brings up side questions about nature vs nurture and free will)
And then consider the lifelong repercussions of the emotional fallout. You can use all the logic in the world to justify the action, but your human brain will still torment you over it. And likely, most of the other human brains that learn about it would torment you as well.
---
So, while I think you can say things like that, ie the ability and allowance, I think you should question whether you should. I think saying those kinds of things really doesn't add much to the discussion because I believe it's really just an uninformed platitude that only someone with a lack of life experience would believe.
For me this all highlights the fact that meaty ethical questions don't have a simple reductive answer. Which ties back in to the original problem that OP outright states that this is simply and clearly the wrong path to go down.
(PS the downvoting/flagging could be due to breaking the guidelines around discussing downvotes and flags, and not actually due to the topical content of the posts, and/or assuming bad faith on the part of other users as such: https://news.ycombinator.com/newsguidelines.html)
>So, while I think you can say things like that, ie the ability and allowance, I think you should question whether you should.
You should because many choice in life are not strictly black and white. Saving a babies life versus introducing gene editing to humanity. If there was a baby where we knew he would grow up to slaughter millions it's absolutely worth talking about. In the age of AI and gene editing where things are influencing what it even means to be human, it is wise to stop and pause for a minute to ask the right question rather then charge forward with change that can't be taken back all because we wanted to save a baby.
I would if I can foresee the future. But with eugenics you can't foresee the future. Self artificially selecting for genetic traits doesn't guarantee a good future. There's no gene for recreating Hitler either.
it's unclear the outcome of this will be eugenics wars.
Answering the real question- it's unlikely these techniques will see widespread "recreational" usage any time soon, as they come with a wide range of risks. Further, the scientific community has learned a lot from previous eugenics programs; anything that happens in the future will happen with both social and political regulation.
It's ultimately hard to predict- many science fiction writers have speculated about this for some time, and social opinion can change quickly when people see new developments.
I think one reason why people won't have children is the gene-editing and the IVF that is coming. Nothing is left to chance, or to god any more. Having children is now a clinical affair. It's spiritually void.
That's part of why the trojan horse works so well, what is an unacceptable risk for someone healthy can easily be acceptable for someone with an otherwise untreatable condition. Then by the experience and knowledge gained, it becomes less risky for everyone.
No, you're assuming that polygenic trait control "scales" like a sort or even a search algorithm, when there's some molecular genetic evidence that it may instead scale like a cipher key size.
If you can affect germline cells, then I don't see how it's not a slippery slope. (I'm not arguing against doing it, just that it is a slope and the slope is slippery.) No designer babies necessary.
I'll steelman "fixing defects" by sticking to serious hereditary diseases (and yes, only those that correspond to one or a few known genes). As more and more conditions become treatable, the population with access to resources will have lower healthcare costs by being less susceptible to problems. (Which is a good thing, note!) Insurance companies will have more and more proxies for differentiating that don't involve direct genetic information. Societally, "those people" [the poor and therefore untreated] cost more to support medically and are an increasing burden on the system. Eugenics gains a scientific basis. Do you want your daughter marrying someone genetically substandard, if you don't have the resources to correct any issues that might show up? Probably not, you're more likely to want to build a wall between you and them. Then throw over anyone who falls behind the bleeding edge of corrections.
It'll be the latest form of redlining, but this time "red" refers literally to blood.
I'm a fan of saying there's always a slippery slope, it's just a matter of the parameters.
But, I think that it's misguided to apply the human problem of othering to a given technology. Regardless of technology X, humans are gonna human. So, if X helps some people, we should consider it on that basis. Because without X, we will still have an endless stream of other reasons to draw red lines, as you allude to. Except in addition we'll also still have the problem that X could've helped solve.
If gene editing to cure diseases leads to a future where people want to shunt off the poor that are now the outsized burden of the healthcare system, the answer from where I sit is to find ways to make the gene therapies available to them, not to cart them off to concentration camps while they await extermination. This will require all the trappings of human coordination we've always had.
Preventing X from ever coming to fruition doesn't at all prevent all possible futures where concentration death camps are a possibility. To me they are orthogonal concerns.
Even if you can convince one culture/society not to do it, how do you stop others? Force? Now you have a different manifestation of the same problem to solve. Society needs to learn how to "yes, and..." more when it comes to this stuff. Otherwise, it's just war all the way down.
> This will require all the trappings of human coordination we've always had.
It is also true to say that we've never had it as quickly as it has been needed, and neither is it done as well as it needs to be. We will blunder into things that are easy to predict in advance if we are willing to look and accept what we see, but we won't.
I absolutely agree that this advance is a great thing and should be pursued further. But I also think that simply categorizing it as good or bad is a way to willfully ignore the unintended consequences. We should at least try to do better.
> Society needs to learn how to "yes, and..." more when it comes to this stuff.
Absolutely. I just think that requires nuance, wide open eyes, and acceptance of uncomfortable truths. Part of the nuance is not boiling it down to a yes/no question of "should this proceed?" (For example, how about: "How can we utilize these new capabilities to maximize benefit and minimize harm, when the only real lever we seem to have to work with is the profit motive? Everything else is getting undermined in its service.")
>For this reason I do not think that curying diseases will lead to designer babies.
Well, you're wrong. Where is the line drawn for what constitutes a disease? Retardation? Autism? Eventually every child below, say, 130 IQ will be considered disabled and unable to find work.
Apply this to every other trait: cardiovascular health, strength, height, vision, etc. All forms of weakness can be considered a disease. The end product of eugenics is that mankind will be made into a docile and fragile monoculture.
>If you want make your baby smarter, taller, or more handsome, it's not so easy because these traits involve 1000s of genes.
And? it's obvious that the technology will eventually be capable of this, just not all at once. It starts with single-gene mutations, then it will be 10's of genes, and then hundreds and thousands.
That is the slippery slope: there is absolutely nothing about your reasoning that prevents one step from leading to another.
He wasn't saying that curing diseases wouldn't lead to designer babies because he objects to the idea (though he might). He's saying that the factors that lead to a "130 IQ" score are, to the extent that they're causatively genetic at all, highly polygenic. Molecular genetics results aren't putting us on a track to predict polygenic behavioral traits (I guess except smoking?), let alone control them.
It's helpful to evaluate claims on this thread in the context of the story. It's possible (though still a very open question) that complex behavioral traits will generally become predictable or maybe even controllable in the future. But those would require breakthroughs (including basic science discoveries breaking in the direction baby-designers want them to) more significant than the announcement on this story.
Honestly to me inequality has been always the main reasonable angle of attacking gene editing. But if vaccines are an analogy, many countries were eventually able to mass vaccinate for dangerous diseases. So this could be only the question of cost, after some period of only elite availability.
There's no inherent metaphysical worth in being on any particular level of strength, height etc., so we can spread whatever is the most convenient. I think arguments against (that I see being made) ultimately devolve into some magical thinking and a priori thing bad. (I am glad to be shown otherwise.) In fact we are already messing with human fertility in possibly unsustainable ways, so maybe more tools are needed as a part of the way out.
Of course there is political execution, corruption etc., but I don't see it any different from other technological challenges that civilization has dealt with. I.e. we need better politics but the tech is not at fault. Gene editing is isolated interventions, so it's in that detail more manageable than for example mass surveillance which is hidden and continuous.
One more esoteric argument is that we cannot socially agree on what traits are desirable. The ‘The Twenty-first Voyage of Ijon Tichy’ scenario. So opposite to "monoculture" in a way. But I don't see people expanding on that.
For a nice thoughtful imagination of said future, Nancy Kress's Beggars in Spain https://en.wikipedia.org/wiki/Beggars_in_Spain suggests one possible outcome. It has both gene editing to make better humans and unproductive masses. A short yet powerful read.
Not to argue semantics here but eugenics is arround selective breeding, this would allow for the opposite, even more breeding, especially in populations with hereditary ailments that would have refrained from the act in prior years. I do agree however that it is imperative greater common-sense regulations surrounding "aesthetic" or "performance" "modifications" (such callous words for young life) will need to be enacted.
As a father, the idea of being told my 1 week old baby is going to die would be my worst nightmare. The fact these doctors and scientists saved this childs life is a monument to modern medical science. This is absolutely insane. Hopefully the child doesnt need a liver transplant, but this is a great leap forward.
Yep, this effort is the culmination of 50 years of research. Could be the last harrah of the NIH with the amount of cuts we've had and the scientists who are taking jobs in other countries.
Indeed - does it matter who performed the research? If the CRISPR reasearch were performed in another country, would that change the outcome for the infant?
And those grant awards need to demonstrate how they benefit the USA. Many are (were) related to disease surveillance in developing countries to prevent pandemics, or collaborations with countries that are more advanced than the US in niche areas.
The technology used on this same article was funded by Max Planck (Germany), Sweden and the NIH to a french and a USA scientist. Should those collaborations stop?
That may be partially true, but it's also important to understand that the US benefited a lot from that. Scientists from all over the world moved to work in the US, students looked forward to studying there and working in US companies, etc.
That is changing. Children in my country are moving from learning English to French and German in order to study in European universities. This started after Brexit and will accelerate now.
The reason for this is very pragmatic actually. We don’t have enough researchers of a particular specialty in one country alone. When you get that specialized the air is very rare.
By pooling our funding / effort we can create a larger body of collaborators to solve problems faster and better.
It could be that the organizations are funding wild stuff that isn’t salient. I’ll concede that.
However, in basic sciences there are so few specialists it is important to share resources. The funding is worse than ever (hello 2006!), and that trend is unlikely to reverse for a while.
Source: I worked in bioenergetics for 10y, my collaborators were from Hungary, Chile, Canada, Israel, Italy, and more! At a major conference on mito energetics they all fit in one big lecture hall (100ish?)
Not to mention the long arcs of the careers of scientists and support staff involved in this breakthrough, who were also supported by federally funded research grants.
Interesting view as many people were so anti-MRNA vaccine because "it was created too fast" oblivious to the years/decades of study in that field that allowed for that "too fast" to happen.
I guess it's still too early in this story's news cycle for the people with anti-views to be making noise yet. No GMOs, but human gene modification is okay. No cloning either. The boogeyman is gonna get us no matter what we do
As the father of a 5 year old boy with a genetic degenerative muscular disease whose lifespan will depend directly on how fast these technologies progress, I have difficulty responding in a civilized manner to the pointless, cruel, and stupid actions of the Administration in this regard. Rage is the word.
It is breathtaking to consider how the members of the Administration and their children, parents, and grandparents have benefited from NIH-funded research in innumerable ways that they are shamefully unaware of, every time they visit the doctor or the ER.
I have the same rage. But it extends equally to those who voted them in and donated to their campaigns, including my own family members.
They have created a huge rift in this country and I am still trying to figure out if I will forgive my family members and what they'd have to do to set us on a path towards reconciliation.
When there's a contract in place to conduct pediatric cancer research, and the government decides one day to break that contract, and it takes courts to rectify the situation, and then the government defies the courts, and the voters are cheering on the illegal actions of the politicians, well, rage is a mild word for what I feel.
The complete lack of self awareness is always breathtaking. Demanding empathy from others while being completely incapable of it yourself is always a stunning thing to encounter.
Do not mistake legitimate grievances for a lack of empathy. It's entirely on republicans to stop being so racist and vile to recover the rest of the population's respect.
Ah yes, the “I can’t be wrong because they’re clearly evil and the cause of all the world’s ills” argument. Sounds so familiar…
Consider that everyone sees themselves as the hero… but that doesn’t mean you actually are, maybe, just maybe you are just as culpable as the person you’re accusing.
Note that you could use your objection to defend nazism too. You can't "moral relativism" everything.
Republicans are currently the ones undermining the foundations or our republic, stripping rights from minorites (Texas just passed a bill that made it illegal to be trans), deporting people with no due process, arresting dissenting politicians and academics.
They're the ones plunging this country into economical ruin, destroying medicare and medicaid to transfer the savings to the 1% through massive tax cuts while letting everyone that depended on these programs die.
Everyone in support of these ideas is intolerant in my book, and I don't see why I should show empathy to a people that would rather see me in a camp.
You like many are confusing pity with empathy. You don’t need to feel bad for them you need to understand them.
Just based on the stuff you say here it’s pretty clear you very closely align yourself with “progressive values”. Many studies show that those who hold progressive beliefs, struggle to even accurately articulate the values and beliefs of those they believe they appose. Much less actually understand them.
You very clearly exhibit this behavior as well.
If you can’t understand the person who’s talking opposite you there is no way to come to an understanding, if you refuse to attempt to understand them, you can’t blame them for the state of animosity.
When I first saw your comment there were no replies, and I thought you were critiquing Trump supporters, and it seemed fairly misplaced with too many absolutes to be an accurate depiction of reality. But I didn't engage because it seemed fruitless to provide minor corrections.
But apparently the partisanship is reversed! You think that I am demanding "perfect empathy" (I am not) and you think I have now shown empathy for my family members (which, you don't know the history). You are describing narcissistic behavior, which is quite endemic in my family members, and having dealt with it for decades I also recognize the attempt to blame others for one's own failing.
Yes, it is all breathtaking, but not in the way you think.
Also, several of the key doctors and researchers were not born in the US. I'm sure plenty of researchers are now thinking twice about working in or moving to the US.
Edit: Still reading the article, but so far researchers working in the US have come from India, Russia, born to Taiwanese immigrants, and more.
One can not simply raise valid concerns about gene editing technologies in the hands of the entities that don't hesitate sending people en masse to kill and die and otherwise manifest their fascist cravings in the open, here on HN and walk away undownvoted
Science fiction pattern matching is a problem nobody talks about. People see something that vaguely resembles a movie that they saw and act like that movie is reality now.
Another problem nobody talks about is the cognitive dissonance of living in the world today but dismissing all matching patterns as science fiction or conspiracy theories. Maybe narrow focus and short attention span are to blame
Maybe they are actually saying "we should take steps to avoid possible futures that we've already established would be bad in our works of art". You can't just hand wave away the idea that some technology could allow for greater invasion of privacy and worse social stratification when we still live in a world where invasion of privacy and social stratification actively occur.
Heck, if parents could provide a trust fund for their kids in a way that their kids couldn't piss it away, they'd be all over it. (I'm sure this exists to varying degrees.)
Look at what wealthy parents already do to get their kids into colleges or out of jail. I think it's ridiculously naive to think that we parents wouldn't jump at the chance to write generational wealth into our kids' genes.
(This is not an argument that developing this capability is a bad thing and should be stopped.)
Fertility care often already included testing for common genetic disorders, and parents with a history of severe disease would often make the hard choice to try again. Due to recent Theocratic political shifts, it means more families will face the worst possible life for their children.
Gattaca was a film years ahead of its time, and raises the question of what happens when people try to "fix" human beings beyond disease prevention. A subtle, but important ethical difference. =3
Disease is fuzzy word, it basically means below some made up bar for healthiness. Take dyslexia as a simple example. That disease can by definition not exist in an illiterate population. We have raised the bar and now they are diseased in need for a cure.
The more we things we cure the higher we will reach and the higher we reach the higher we will raise the bar. I don't think that's a bad thing, but its worth bearing in mind.
Various learning challenges would fall outside a lifetime of suffering, and often such kids have statistically higher IQ. ;)
I think it is more likely people will create synthetic diseases by experimenting on human beings with unique unpredictable gene expression.
He Jiankui already crossed the ethical boundary in 2018... only to discover his best intentions were still nonsense. The GMO kids he helped edit will have a lifetime to figure out if that alteration negatively affected them, and as adults consider how their own children may change.
People may cross the "Primum non nocere" line, but it can never ethically be justified =3
I'd say Gattaca touches on how easy it is to edge a little over the line of what is a "disease". For example this scene touches on "prejudicial conditions" like baldness: https://www.youtube.com/watch?v=pCN5QG8Jtwg
Speaking as a person whose friend died at 21 from complications related to cystic fibrosis I would like to see these diseases edited out of the germ line.
No, it's only in the liver, from what I can tell from the science, not the gametes.
No, it would not depend on the sex of the baby, as the chromosomes that you're editing aren't X or Y.
Evolutionarily, the inheritance of genes is a far slower process than the medical advancements we make, so what I think we're seeing here is a chasing down of the low probability events. In that, most of the evolutionary pressure is coming from things like dirty water and bad food, but as we're solving those low hanging fruit, we have to go to lower probability events to make progress that feels equally important.
Also, if I am wrong here on the answers to the questions, please correct me!
If they could get complete delivery to the liver stem cells, then the change could be permanent, although this is making many simplifications.
Organs in your body usually keep some very old cells (formed in the embryo) around which act as parents for all the new cells in an organ. Any cell can only divide a limited number of times, so they typically maintain a "tree structure" where the old cells create children and grandchildren (etc) that then differentiate into the organ-specific cells that do the actual organ work.
If you modify only the differentiated cells, eventually they die, and are replaced by descendents of stem cells; if those stem cells didn't get modified, their descendents will not have the fix, and the treatment efficacy reduces over time.
That‘s what I was asking: Baby females already have all the eggs they will ever have once they are born, right? Matryoshka doll style. While sperm is always (relatively) fresh.
Both eggs and sperm producing cells are created during formation of embrio. We could even define that these cells as "clones of you" that were created not much after your first cells were created, because your DNA, that undergoes changes in your organism is never given to your offsprings - it is DNA of your "clone" cells.
Eggs are as you have defined - "very old cells". Most probably cells that are producing sperm also can be defined as "very old cells" as most probably sperm production does not function the same way as other cells, that are staying in organism and accumulate mutations.
Stem cells from other organs has absolutelly nothing to do with this. Unless you are refering to procedures of planting stem cells from one organ to another to help failing organ, as stem cells are universal cells, that are able to produce cells for any organ.
Is the global gene pool actually degrading though? I only ever hear that in thinly veiled attempts at advocating for eugenicism. And it never comes substantiated by any research.
Anyway, this baby proves we can fix hereditary diseases now.
The issue here is that with this approach we have to ask who has to be limited next. Especially if you get older...
>>>You can‘t seriously tell me it‘s not extremely unethical for people with huntington‘s disease or cystic fibrosis to have children.
Don't flatter yourself - your genes are basic and ridddled with bad genes. You do not know what time bomb you are carying in your DNA.
The solution that you are offering is quite simple - procreate early as possible and die not in old age and voila - there are no issues in more than 99.99% cases. But something tells me that you are already older than healthy monkey and do not plan to live in a tree - your bones are too old for that and thanks to evolution are not meant for that.
Evolution of humans in future includes even longer lifespan which naturally comes with children produced at much later age than we do now and that comes with diseases to be dealt with, as that is part of evolution. We do not know much about mutations in DNA - they are never good or bad - they are combinations of something. For example - diabetes type 2 seems to be from genes, that allowed humans to survive hunger for long period of time - are those genes bad, because people are obese nowadays?
As for mentioned diseases - we value other humans not by DNA, but what they are to us. You would sing a different song, when their offspring would have any of such disease and you are in luck and not planning to have any.
Most genetic diseases only occur when two parents happen to have it, but they won't necessarily be aware of it; would it be unethical for people who are unaware of their genetic defects to have children?
Second, according to a quick search, 10% of cases of Huntington's Disease are due to new mutations; I suspect (but I'm a HN commenter, no geneticist) this is the case for many other genetic conditions.
So the other ethics question to ask: should people be able to get DNA tests for genetic conditions (voluntary)? I'd say yes. Should people be mandated to get DNA tests and be forbidden to procreate if there's something in there? No, that's eugenics. Should people who know they have a genetic condition and there's a chance their child has it too have children? That'd be their choice. I don't think it's fair for people to intentionally place a burden on health care systems like that, but thing is, there's very, very few people that have children with that as the intent.
We can pause and acknowledge that life (and what that means) will change, while also acknowledging that for many it will be the easiest decision in the world for it to change.
I think it's a tool that can be used for great good. But also can be used for eugenics. That's why I pasted the link. It's a slippery slope. What a parent will do for their kids knows no bound.
> But KJ’s treatment — which built on decades of federally funded research — offers a new path for companies to develop personalized treatments without going through years of expensive development and testing.
Really incredible story and I'd love to know the process for receiving this, for example FDA approval etc. It's nice to see such in-your-face results from Federal funding programs. Without being political, it's sometimes hard for regular people to appreciate just how much good actually comes out of Federal Funding. There was another thread where someone even said something along the lines of : "Well during war things get done faster" . This simply isn't true. It might be done louder but Federal Funding never stopped pushing things forward.
It would be nice, but you know how politics can usually turn into a bit of a toxic environment online. That said, I personally don't see the DOGE thing as anything other than a way to reduce the power of regulatory enforcement. I'm sure someone who would want that would never be conflicted with interests there...
I mean, the article is explicitly written to put it on your mind:
"The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services."
"But KJ’s treatment — which built on decades of federally funded research"
"The result “is a triumph for the American peoples’ investment in biomedical research,” Dr. Urnov said."
"The researchers emphasized the role government funding played in the development."
"The work, they said, began decades ago with federal funding for basic research on bacterial immune systems. That led eventually, with more federal support, to the discovery of CRISPR. Federal investment in sequencing the human genome made it possible to identify KJ’s mutation. U.S. funding supported Dr. Liu’s lab and its editing discovery. A federal program to study gene editing supported Dr. Musunuru’s research. Going along in parallel was federally funded work that led to an understanding of KJ’s disease."
"“I don’t think this could have happened in any country other than the U.S.,” Dr. Urnov said."
This is an article about federal funding of medical research with a cute baby as the human interest bit.
Here's the thing - likely few would have noticed. We are structurally blind to the places in which public investment would have made our lives better, especially when they are things like scientific research that the vast majority never think about until it produces results.
I'm not an expert, but I have learned that FDA approval is not actually necessary for treatments and drugs. Your doctor has a lot of leeway when it comes to treatment but she of course experiences more risk of accusations of malpractice when prescribing off label drugs or unapproved treatments. insurance will also rarely cover treatment that is not FDA approved. the requirement for FDA approval generally has more to do with your legal ability to market the drug, treatment, or product.
That's actually super interesting and kinda great to hear, I guess my follow up question is obvious but would insurance companies cover that kind of procedure in the US? I get the impression it wouldn't be.. but if out of pocket.. I know I'd absolutely do anything for my kid.
Edgy! No one has ever considered the mortality of their children ever, or contemplated the difference between death before and after the realization of potential. Wow!
Having a child predecease you is one of the worst things that can happen to a person in general. This is a common sentiment in humans. The strange thing is that you mentioned you're trying to follow "logic." This is not logic. These are emotions.
I understand this. My question arose from the fact that it seems like he only cares about the child dying before him, not the child's death overall. It was
> the idea of being told my 1 week old baby is going to die
> have I failed my baby so much as a parent that he won’t even grow to adulthood (much less have a wonderful, happy life)
It’s not exactly a rational feeling; it’s not like this baby was going to die through lack of parental effort or care or anything else that the parents have any real control over, so it’s not like they could have done anything differently.
Nonetheless, it can make you feel like an utter failure of a parent. To some people (I admit, not everybody), that is absolutely crushing.
I don't really know what you're going on about? We're all going to die, we all know that that's going to happen, but none of us want to suffer and most of us would like to live relatively long lives.
I am not a parent but I think if I did have a kid I would try everything I could to keep my child alive and minimize pain in my child's life.
A parent's obligation is to try and do everything they can to make their child's life good. I think most people would agree that living more than a week is a good thing.
You are trying to frame this as pure “logic” but if you had read a single book on ethics or even philosophy you would see that’s not the case. You are basically asking “but why is good better than bad?” Acting as if you are logical but failing basic premises of logic or ethics. Any ethical framework is going to have axioms, typicslly these axioms are things that are inarguable for any person, namely its better to live than die, or to reduce suffering, etc. using basically any ethics system and pure logic you will quickly reach a conclusion that a baby living is better than one dying.
This really has nothing to do with the inevitability of death. Death is inevitable, however there is a difference between a child dying and an elderly person dying. A child has potential, they have not lived their lives. A child has not actually lived the full basic human experience, they havent had a crush, or fallen in love or married or had children or had any great successes or failures or close friends or anything, these things everyone does. An older person has, they are not a pure soul who hasnt experienced life. After 70 years you can be sad for the individual passing but happy that they have experienced life. This is why when a parent has a child they arent sad that their child will die in 80 years, but are devasted if they die at a week. The child never even had a chance. When you actually have a child, its an emotional and fulfilling experience, and to have that torn out so early is damaging.
From an empathy and emotional pov these things are so extemely basic and foundational aspects of being a human, a 10 year old from any culture on earth can undersrand this with no difficulty. And any person with even a passing familiarty with logic, ethics or philosophy will dismiss you as being earnest. Which is why people are assuming you are a troll.
So what? So a father shouldn't celebrate medical advances that mean their kid doesn't have to die after a week? And if it does, they should just be like "Ah, that's life!"
Oh, sorry. I definitely think a father can (should?) celebrate medical advancements like this, and definitely shouldn't undermine death like "Ah, that's life". My point is that people often worry about their children's death when they themselves are still alive. Death seems okay if it's when they don't get to see it
Only 1% of the population has autism. Presenting autism as a considerable possibility for trollish behavior isn't much different than what the parent commenter did.
Is there more context to this question? I couldn't read the article because of the pay wall. But in isolation, this is a dumb question. All decent parents want their child to live as long as possible and be as healthy as possible. Is there something deeper you were trying to get at?
My bad. I had been reading about how there's a frustration in the community that allistic people refuse to explain why such statements are wrong, and instead just repeat "you know what you did!" to people who genuinely don't.
I tried to be the one who didn't do that, but missed the mark. I'd delete it if I could.
I suggested a few that covered your multiple comments in the subthread, and also people who are sincere about using HN in accordance with the guidelines and the site's intended purpose have a way of demonstrating it through their actions. If you want to contribute here, please make an effort to be a positive contributor.
> I suggested a few that covered your multiple comments in the subthread
I genuinely can't link any of these to any of my comments, that's why I'm asking. I reread those a couple of times. I really think I've been polite, and I really tried to be, even when called "beteft of humanity", "earnest" and accused of trolling. I did not insult anybody, didn't want to and I certainly didn't want to bring anyone down. I just asked a question that seemed (and still seems) logical to me, only to get shutdown by mass flagging, now by removal of the comment with no real explanation what rules I broke and why I was negative
OK, maybe there's a cultural or language disconnect here, so, if you're genuinely confused as to why this came across as offensive, I believe you.
Please just understand that it can be upsetting to many people in the HN audience, as evidenced by the votes and comments, when the topic of death is addressed in this way: i.e., in a way that seems hyper-rationalist and diminishing of the way premature death – especially of infants and children – is particularly devastating to parents and loved ones.
> OK, maybe there's a cultural or language disconnect here
I might be just shit at expressing my thoughts in English
> when the topic of death is addressed in this way: i.e., in a way that seems hyper-rationalist
This is why I kept pushing and asking - I thought that HN is all about logical thinking and not letting your emotions go through and think for you.
I don't know if you are still insisting that I broke the rules - you don't have to explain in which way I broke them, I understand that I don't understand. A simple yes or no would suffice, if I could ask you.
And thank you for taking the time for discussing this with me. Regardless of the answer for the above question I will refrain from talki
I wonder if this also affects germline cells so he won't pass the same disease on to his children. If it does, that would be a complete departure from almost all medical treatments we use because most of them are just compensating for the effects of bad genes and leaving them in the gene pool to degrade the health of future generations.
What an insanely callous and shallow take. I don’t even know where to start. You’re trying to claim the moral high ground by complaining that a privileged child didn’t suffer and die? Do you even understand the point of reducing poverty?
An absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer.
How many people can even afford to get multiple opinions for a weird lump on their back? Or go to the dentist for a strange toothache? How many people can afford to get consistent exercise and eat healthy? How many lives would be saved or at least massively bettered? We already have the means to extend the life expectancy of the average person, and it's not being used. Obviously this is a wonderful medical advance, but it's depressing to wonder who it's for.
Certainly, you may choose to conduct yourself like this. I won't stop you! And other people who might've otherwise seen your point will be turned away from it. I prefer to have constructive conversations with people I view as equals, not stupid or infantile.
Observe that the replies to my post do engage with the argument I made.
> An absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer.
I'm as negative about the rich and powerful as anyone but this is such a cynical take - that might have been applied to many medical treatments in the past that have become relatively commonplace and easily accessible to people of all classes, at least in sane countries with sane healthcare systems.
Indeed, my view is heavily American-centric. And the trends of the past-- which you're right about-- may not apply to the future given increasing wealth inequality, the cost-of-living crisis, and the climate crisis (for which undoubtedly the poorest of us will be forced to shoulder most of the burden).
I'm explicitly not saying this work shouldn't be done, it should! But it does not exist in a vacuum, and it would be silly to pretend that it is not colored by vastly unequal access to modern healthcare. The reason I get excited about technology is because of the potential it holds for making us all happier and freer to do the things we like for longer. We are lost if we do not at least speak about the thunderclouds on the horizon for this philosophy of technology.
What are you talking about? Since the 1800s people have been shipping vaccines to "most of the world"
Everyone could afford to "eat healthy" and get exercise if governments and social planners put in a modicum of effort. Unfortunately they aren't directly incentives to do so.
Framing either of these things as a wealth issue ignores both how wealthy even the poorest in the world are and the systems responsible for the problem. For everything else there's health insurance, yet another horribly mismanaged system.
When my second son was born and was just so very tiny some genetic test came out questionable. We were very strongly encouraged to go to Childrens hospital ASAP to get more tests. He handled it well, being just a few weeks old. The tests came with "he's a carrier of something obscure but nothing to worry about", so it's all forgotten.
Three interesting thing come out of it from me. First, I was on Microsoft insurance which was quite gold plated at a time, a blessing only obvious in rear-view mirror, because Childrens was quite excited to continue any number of tests. Second, the technology of all this is absolutely amazing and I am so happy that it was available to me, and it has likely gotten better. Three, I want that tech to continue to expand and current destruction up there is going to hand this torch to someone else, which makes me sad.
> I was on Microsoft insurance which was quite gold plated at a time
One of the biggest perks of working for Microsoft for a long time was their health coverage. I can't tell you the number of times I'd be doing initial paperwork for a doctor's appointment and the receptionist would be like, "Oh you have THAT insurance, we're going to do all of the tests." I've heard they since cut back on it a little, but it truly was gold plated.
;) Paradox of choice potentially, but allowed choosing something other than Kaiser Permanente (HMO with own facilities and doctors) such as a PPO option.
What America really needs is an NHS not tied to employment or exploited by fraudsters delivering worse care for profit. Human rights shouldn't be perks of employment.
My niece in Australia has a rare genetic disorder and when my wife and I had our first baby in California a few years ago we were concerned about that. We also had fantastic insurance and the hospital team there did a test where they took a blood sample from my wife and seperated the childs DNA from the mothers in the blood sample and tested it for several genetic disorders. That test is not available in Australia even today.
Incredibly that test (cell-free fetal DNA - cfDNA) is now standard in California, to the point where most expecting parents in California now learn the baby’s gender super early. We learned our baby’s gender only 10 weeks into pregnancy because of the cfDNA test.
> That test is not available in Australia even today.
Pretty much every lab test is available in Australia if you are willing to pay for it; if they don’t have a local lab capable of running the test, they’ll send the sample overseas
The real question is whether it is covered by insurance or not, and a lot of the time the answer is “no” - I recently forked out over US$500 for genetic tests on one of our kids (which the paediatrician recommended), although the results weren’t particularly helpful (“rare variant of uncertain clinical significance”)
If someone in the year 2050 was to pick out the most important news article from 2025, I won't be surprised if they choose this one.
For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body.
We still are struggling in most cases with how to deliver the DNA update instructions into the body. But given the pace of change in this space, I expect massive improvements with this update process over time.
Combined with AI to better understand the genome, this is going to be a crazy century.
The “How to make superbabies” article demonstrates a couple of fundamental misunderstandings about genetics that make me think the authors don’t know what they’re talking about at a basic level. Zero mention of linkage disequilibrium. Zero mention of epistasis. Unquestioned assumptions of linear genotype-phenotype relationships for IQ. Seriously, the projections in their graphs into “danger zone” made me laugh out loud. This is elementary stuff that theyre missing but the entire essay is so shot through with hubris that I don’t think they’re capable of recognizing that.
The EA community is generally incapable of self-awareness. The academic-but-totally-misinformed tone is comparable to reading LLM output. I've stopped trying to correct them, it's too much work on my part and not enough on theirs.
Technically lesswrong is about rationalists not effective altruists, but you're right in a sense that it's the same breed.
They think that the key to scientific thinking is to forego the moral limitations, not to study and learn. As soon as you're free from the shackles of tradition you become 100% rational and therefore 100% correct.
That community is basically the "r/iamverysmart" types bringing their baggage into adulthood. Almost everything I've read in that sphere is basically Dunning–Kruger to the nth degree.
Approximately no one in the community thinks this. If you can go two days in a rationalist space without hearing about "Chesterton's Fence", I'll be impressed. No one thinks they're 100% rational nor that this is a reasonable aspiration. Traditions are generally regarded as sufficiently important that a not small amount of effort has gone into trying to build new ones. Not only is the case that no one thinks that anyone including themselves is 100% correct, but the community norm is to express credence in probabilities and convert those probabilities into bets when possible. People in the rationalist community constantly, loudly, and proudly disagree with each other, to the point that this can make it difficult to coordinate on anything. And everyone is obsessed with studying and learning, and constantly trying to come up with ways to do this more effectively.
Like, I'm sure there are people who approximately match the description you're giving here. But I've spent a lot of time around flesh-and-blood rationalists and EAs, and they violently diverge from the account you give here.
So much vitriol. I understand it's cool to hate on EA after the SBF fiasco, but this is just smearing.
The key to scientific thinking is empiricism and rationalism. Some people in EA and lesswrong extend this to moral reasoning, but utilitarianism is not a pillar of these communities.
Empiricism and rationalism both tempered by a heavy dose of skepticism.
On the other hand, maybe that is some kind of fallacy itself. I almost want to say that "scientific thinking" should be called something else. The main issue being the lack of experiment. Using the word "science" without experiment leads to all sorts of nonsense.
A word that means "scientific thinking is much as possible without experiment" would at least embedded a dose of skepticism in the process.
The Achilles heel of rationalism is the descent into modeling complete nonsense. I should give lesswrong another chance I suppose because that would sum up my experience so far, empirically.
EA to me seems like obvious self serving nonsense. Hiding something in the obvious to avoid detection.
Effective Altruism is such an interesting title. Almost no one views their Altruism as ineffective. The differentiator is what makes their flavor of Altruism effective, but that's not in the title. It would be like calling the movement "real Altruism" or "good Altruism".
A good name might be rational Altruism because in practice these people are from the rationalist movement and doing Altruism, or what they feel is Altruism. But the "rationalist" title suffers from similar problems.
I suppose in the beginning, it was about finding ways to measure how effective different altruistic approaches actually are and focusing your efforts on the most effective ones. Effective then essentially means how much impact you are achieving per dollar spent. One of the more convincing ways of doing this is looking at different charitable foundations and determining how much of each dollar you donate to them actually ends up being used to fix some problem and how much ends up being absorbed by the charitable foundation itself (salaries etc.) with nothing to show for it.
They might have lost the plot somewhere along the line, but the effective altruism movement had some good ideas.
> One of the more convincing ways of doing this is looking at different charitable foundations and determining how much of each dollar you donate to them actually ends up being used to fix some problem and how much ends up being absorbed by the charitable foundation itself (salaries etc.) with nothing to show for it.
Color me unconvinced. This will work for some situations. At this point, it's well known enough that it's a target that has ceased to be a good measure (Goodhart's Law).
The usual way to look at this is to look at the percentage of donations spent on administrative costs. This makes two large assumptions: (1) administrative costs have zero benefit, and (2) non-administrative costs have 100% benefit. Both are wildly wrong.
A simple counterexample: you're going to solve hunger. So you take donations, skim 0.0000001% off the top for your time because "I'm maximizing benefit, baby!", and use the rest to purchase bananas. You dump those bananas in a pile in the middle of a homeless encampment.
There are so many problems with this, but I'll stick with the simplest: in 2 weeks, you have a pile of rotten bananas and everyone is starving again. It would have been better to store some of the bananas and give them out over time, which requires space and maybe even cooling to hold inventory, which cost money, and that's money that is not directly fixing the problem.
There are so many examples of feel-good world saving that end up destroying communities and cultures, fostering dependence, promoting corruption, propping up the institutions that causing the problem, etc.
Another analogy: you make a billion dollars and put it in a trust for your grandchild to inherit the full sum when they turn 16. Your efficiency measure is at 100%! What could possibly go wrong? Could someone improve the outcome by, you know, administering the trust for you?
Smart administration can (but does not have to) increase effectiveness. Using this magical "how much of each dollar... ends up being used to fix some problem" metric is going to encourage ineffective charities and deceptive accounting.
That's fair enough, there are problems with this way of thinking. I suppose you could say the take-away should be "Don't donate to charities where close to your whole donation will be absorbed as administrative costs". There definitely are black sheep that act this way and they probably served as the original motivation for EA. It's a logical next step to come up with a way to systematically identify these black sheep. That is probably the point where this approach should have stopped.
The vast majority of non-EA charity givers to not expend effort on trying to find the most dollar efficient charities (or indeed pushing for quantification at all), which makes their altruism ineffectual in a world with strong competition between charities (where the winners are inevitably those who spend the most on acquiring donations).
Do you really think all altruism is effective? Caring about the immediate well-being of others is not as effective as thinking in the long term. The altruism you are describing is misguided altruism, which ultimately hurts more than it helps, while effective altruism goes beyond the surface-level help in ways that don't enable self-destructing behaviours or that don't perpetuate the problem.
No I think almost all people doing altruism at least think what they are doing is effective. I totally get that they EA people believe they have found the one true way but so does do others. Even if EA is correct it just makes talking about it confusing. Imagine if Darwin has called his theory "correct biology".
>Almost no one views their Altruism as ineffective
As someone who has occasionally given money to charities for homelessness and the like I don't really expect it to fix much. More the thought that counts.
Note that these people often condescendingly refer to themselves as "rationalists," as if they've unlocked some higher level of intellectual enlightenment which the rest of us are incapable of achieving.
In reality, they're simply lay people who synthesize a lot of garbage they find on the Internet into overly verbose pseudo-intellectual blog posts filled with both the factual inaccuracies of their source material and new factual inaccuracies that they invent from whole cloth.
I still think there's a lot to learn from those articles for most folks uninvolved in this area, even if some of their immediate optimism has additional complications.
I think what I mostly took away is a combination of technologies is likely to dramatically change how we have babies in the future.
1. We'll make sperm/egg from skin cells. This has already been done in mice[1], so it is not science fiction to do it in people.
2. When we're able to do this inexpensively, we could create virtually unlimited embryos. We can then select the embryos that have the most optimal traits. Initially, this may be simple things like not choosing embryos with certain genes that give higher risk of certain diseases.
This may involve selecting traits like intelligence and height (there are already companies that offer this embryo selection capability [2]).
3. Instead of creating a lot of embryos and selecting the best ones, we could instead create just one embryo and edit the DNA of that embryo, which has already been done in humans [3]. Alternatively, we could edit the DNA of the sperm/egg prior to creating the embryo.
The fact that none of this is science fiction is just wild. All of these steps have already been done in animals or people. Buckle up, the future is going to be wild.
Low hanging fruit is very low hanging in this case. There are many point mutations for example that confer risk to disease and cancer. Lynch syndrome which confers significant risk for colorectal cancer for example is something that could he cured with transgenic humans today even with todays technology. Just a matter of screening gametes for the mutation (usually one base in the case of Lynch in heterozygous state with wild type healthy allele and that wild type healthy allele gets a second hit mutation as the cancer develops and things just go off the rails from there) and editing that base back to wildtype. No downside only upside with that.
What gets harder are polygenic traits that even today we don’t have great data on what are the causal alleles. But that is also not a technological limitation either but a statistical one from insufficient sampling of these polygenic phenotypes.
I also wonder what happens if this kid one day has kids. In this case it was a very rare genetic disease, but if the same was applied to a less rare genetic disease (where it is also more beneficial to have a treatment as more people have use of it) wouldn't the end result be that more and more kids will be born with these diseases?
There's no "most optimized human". We are already that, perfected in millions of years. What could really happen is the split between multiple sub-species. For example, it makes perfect sense to do the optimization for orbital station dwellers or Mars colonists or underwater dwellers.
We’re not perfect, we’re just good enough to have survived.
There are lots of hereditary illnesses and conditions that could probably be tweaked with DNA editing, if we can identify the responsible genes. If someone can cure male pattern baldness they’ll be rich.
That's all very cool, but there are also articles like this one: https://www.theguardian.com/us-news/2025/feb/20/trump-nih-cu... - I'm not able to read the Times article because it's paywalled, but as other commenters have mentioned, this research was funded by the NIH, which the Trump administration is currently in the process of defunding. So, if further progress along this road will be made, it'll probably be much slower and less likely to be in the US.
Or, it means that funding will be secured in the private sector. Basically by investors that focus on revenue streams (read: extremely expensive private healthcare).
Yeah, maybe for stuff like this which (now) has direct applications, yes. But for basic research (and it took decades of basic research on genetics, gene editing etc. etc. to get to this point)? No way...
Easiest way to do this stuff is before fertilization when you have one egg and one sperm to work with. Delivering change through a multicellular organism is very challenging. All this stuff like transgenic mice are set up in mutant crosses before this stage, before mating really.
Eventually this will be the outcome of our species to edit the gametes themselves. The issue to overcome for this again won’t be technological as that is pretty much solved but getting people over their own “ick” factor.
>>>Easiest way to do this stuff is before fertilization when you have one egg and one sperm to work with.
Yes. But it seems, that nature so far is still better than we at picking better quality cells in laboratory environment. Not all eggs and sperms are equal - the difference in DNA quality varies.
>>>Eventually this will be the outcome of our species to edit the gametes themselves. The issue to overcome for this again won’t be technological as that is pretty much solved but getting people over their own “ick” factor.
This is a new fear unlocked, as this will be like another cosmetic surgery procedure, which from my minimal understanding does not affect DNA that is delivered to offsprings - that could be changed but require a lot more work, but like you mentioned - it is easier to do before fertilization :). It is catch22 situation rn.
>The issue to overcome for this again won’t be technological as that is pretty much solved but getting people over their own “ick” factor.
Probably requires getting investors over their profit incentive first, why treat a heritable disease for the offspring if you can charge them on a per person basis?
> For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body.
How to avoid having only parts of the liver with the new DNA, and some other parts with the old DNA? Like a chimeric liver - isn't this something bad?
The wealthy are already engaged in eugenics via IVF embryo selection. There are several American startups whose clientele are mainly rich SV types that want to optimize the genetics of their children.
Hmm, I thought clinical gene editing (gene therapy) was frowned upon because it's inherently risky and fraught with ethical hazards. What technically and ethically has changed since 2005 beyond CRISPR?
Germline gene editing is still considered risky and unethical. That is, editing cells that form eggs and sperm, thus changing the genome of some of the descendants of the edited person. This is somatic editing. These edits will not be inherited.
Somatic editing is becoming more common (see Casgevy) but there are technical hurdles that prevent its application to many cases.
> This is somatic editing. These edits will not be inherited.
Genuine question- how do we know that? Is it just that the edits are very improbable to accumulate in the gonads in sufficient quantities to persist? We can’t actually prevent some fraction of them from reaching other parts of the body, right?
I'd like to know that too. When a gene therapy is administered to a person after birth, what % of cells get the edit and with what approach(es)? Doesn't that also edit oocytes and spermatocytes too?
569 comments
[ 2.9 ms ] story [ 399 ms ] threadBetter to have more disabled or dead babies instead of science.
/s
He was jailed for illegal medical practices but it seemed like he established a proper lab after serving the sentence and hopefully he is focused on less objectionable practices. https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
That's not to say the research itself is not impressive nor important, but think critically about the fact that this money doesn't exist in a vacuum.
How confident are you the answer isn't very close to zero? We've already curtailed smoking quite a bit in the past 30 years. At the level of an individual, it isn't any particular mystery how to stop obesity or to simply not drink, but population-level interventions attempting to get people to voluntarily behave differently for their own health historically haven't worked well in these specific domains. Throwing more money at the problem doesn't seem like it would obviously change that.
Also keep in mind that overeating and alcohol addiction have significant genetic components. Research into gene editing has the eventual potential to cure damn near any disease, including whatever pet causes you personally think are worth defeating.
Said like that it paints things like there are not far more resources spent on propagating the bad habits (as some ROI is expected from this by some actors), and any attempt to put a social health program in history always ended in major catastrophes.
Maybe even the dirt cheap one, because even 100 dollars could go longer way somewhere in the Sahel.
It is good that the humanity does not have a one-track mind.
I could say I believe the government should fund research into fixing people who think cilantro tastes like soap because for most of us it is delicious and promotes healthy diets. Should I be able to compel (tax) you to pay for that research?
Where that line is drawn will always be wrong to someone. How research is prioritized will always be wrong to someone. Is there an ethical way to determine the best use of collective resources and what portion of one’s property must be taken from them to fund that research.
The cilantro taste stuff does not sound absurd to me at all. In biology, there is no hard wall between banal stuff and critical stuff; they interact and fundamentally operate in the same environment under the same genetic and epigenetic rules. Sure, the research necessary for correcting cilantro-as-soap may be marginal, but there is a chance of discovering something significant along the way.
We should be more careful and also honest when communicating about science to taxpayers.
BUT the long term view of creating a technology that can treat any genetic illness (or maybe even any illness?) must outweigh that _eventually_
In reality, as this process becomes more mature it is going to become inexpensive.
The reduction in cost will almost certainly be similar to reduction in cost needed to sequence an individual's genome, which has fallen from tens of millions to hundreds of dollars.
The only catch is that we have to spend money to get there.
Another catch is that the nations who underwrite this research will turn millions in investments into trillions in dividends and the stingy or poor will be left in the cold.
Seeing that private enterprise is only good at taking publicly-funded work and patenting it, and that in the absence of public funding nothing ever gets invented, we should be all-in on this.
edit: it's apropos that you mentioned obesity because GLP-1 drugs are the direct, irrefutable, product of spending at government labs.
edit2: specifically, a single government scientist playing around with lizard saliva in the 1970s because he thought it was interesting.
There's no evidence to support that gene therapy will ever be inexpensive. We can merely say that the process may become less shockingly expensive.
Sending robber barrons and their girlfriends into space?
When a Utopian dies, of anything, the cause is marked and not forgotten until solved. A fall? They rebuild the site to make it safe. A criminal? They do not rest until he is rendered harmless. An illness? It is researched until cured, regardless of the time, the cost, over generations if need be. A car crash? They create their separate system, slower, less efficient, costing hours, but which has never cost a single life. Even for suicide they track the cause, and so, patiently, blade by blade, disarm Death. Death, of course, has many weapons, and, if they have deprived him of a hundred million, he still has enough at hand to keep them mortal. For now.
My prediction is based on the number of efforts, too numerous to list here, being undertaken to develop lab equipment to automate the extremely labor-intensive workflow and the accumulation of vast libraries of CRISPR-Cas9 screens and dependency maps, the creation of which are also expensive and labor-intensive.
A similar thing has been said about so many cutting edge therapies and technologies in the past that I think you'll end up being quite surprised.
Eventually someone will invent a machine that spits these therapies out like espresso machines.
Getting a new drug or therapy approved for a rare form of a disease and then expanding the indication to the common disease patient population is a well established strategy.
This is something beyond that, and is very valuable as this baby has no actual means of fighting this issue at all.
And who's to say this won't lead to fixing the other things anyway.
Great use of dollars
There are known DNA changes that would probably help all people with chronic diseases, but it's ethically more accepted to go for the more fatal diseases and cleaner cases first, like a rare mutation with a high fix rate.
Instead if no resources is allocated on developing all the technical requirements to do such a thing, humanity ends up with less tools to heal itself, and that's it.
b) the whole point of NIH and other government research funds is to pay for this sort of "not clearly an effective use of dollars" type of research that Pfizer et al won't touch. but you can look at a ton of future applications from this - lipid packaging, CRISPR methods, drug delivery, etc that had to be devised, and could conceivably be commercially viable if the methodology is perfected and the cost comes down.
Of course they do. But untold amounts spent on very few kids could be spent elsewhere on many more. Federal budgets are a zero-sum game.
> Also, I think when they say they want more babies, they want a specific subset of babies to increase.
I've seen quite a few conservative commentators celebrate that the massively disproportionate levels of African-American abortion have been reduced, resulting in more African-American people being born, and zero bemoaning it. So maybe you're right.
This is _not_ the first human to be treated with a treatment under the wide umbrella of gene therapy based on their own edited genes. There probably is a more narrow first here but the technical details get lost in journalism which is a shame.
What's intriguing is not the 'custom' part, but the speed part (which permits it to be custom). Part of what makes CRISPR so powerful is that it can easily be 'adjusted' to work on different sequences based on a quick (DNA) string change - a day or two. Prior custom protein engineering would take minimum of months at full speed to 'adjust'.
That ease of manipulating DNA strings to enable rapid turnaround is similar to the difference between old-school protein based vaccines and the mRNA based vaccines. When you're manipulating 'source code' nucleic acid sequences you can move very quickly compared to manipulating the 'compiled' protein.
That was one of the first cases of _germline_ gene editing using CRISPR - NOT "the first instance of gene editing." There have been quite a few other genetic editing tools that predate CRISPR, and there have been other edits using CRISPR that were not of the entire human's genome.
https://www.whatisbiotechnology.org/index.php/science/summar...
https://youtu.be/J3FcbFqSoQY
https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
This research is instead a therapy used to treat an already born baby, and it doesn't modify all the cells in the body. Many cells in the body that are transformed by this technique will eventually die and be replaced by clones of stem cells which weren't transformed. I haven't read in detail about whether this therapy targets stem cells, and how long term effective the treatment will be- hepatocytes (liver cells) turn over constantly, so I would expect if the treatment did not affect the hepatocyte stem cells, it would only last ~months and the treatment would have to be repeated.
A quick search suggests that liver regen involves dividing mature liver cells to replace turnover. If so, I'd suspect that they'd continue to carry the.crispr edit forward.
Pandering to people's fragile political sensibilities is how the U.S. got to this point where millions of citizens voted against their own self-interest because they thought candidates running on anti-intellectual, anti-science platforms was worth the zero sum "win".
Enjoy your weekends, eight hour workdays, clean air, and clean water—whether you like that those were all political or not!
That is one of the most incredible things I have ever read.
(core war, anybody?)
The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem
About CRISP, it's like the ultimate Perl+Regex for the body.
I misread this as "fleshy" for a moment, and the quote almost works better that way.
True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.
Hilarity subsequently ensues.
Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.
Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.
Which, yeah, that's a miraculous discovery. And it was well worth the 2023 Nobel in Medicine.
Like, the whole system for gene editing in vivo that we've developed is just crazy little discovery after crazy little discovery. It's all sooooo freakin' cool.
https://en.wikipedia.org/wiki/Pseudouridine
That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports.
That's bad if your goals are to detect genetically modified people and discriminate against them.
I see a near future where the kind of people who loathe things like vaccines and genuinely believe that vaccines can spread illness to the non-vaccinated feel the same way about other things like genetic modification and use legal mechanisms to discriminate and persecute people who are genetically modified.
I'm not totally sure. If I understand it correctly, the mRNA contains pseudouridine, and it makes the protein that will edit the DNA. The edited DNA should look like a normal one.
[And no, I am not anti-vax, nor anti-gene-editing.]
I'm not arguing about whether the risks of the attenuated virus outweigh the benefits. I think the data are very clear there. (Heh -- and I'm sure the vast majority of people will agree with that statement, even if they disagree on what the clear answer is....)
It's just that one shouldn't mock a belief without including the necessary qualifiers, as otherwise you're setting up an argument that can be invalidated by being shown to be factually incorrect.
As for genetic modification of humans, IMO there are a lot of very good reasons to be wary, most of them social. Fatal hereditary conditions are obviously an easy call. What about autism (not saying there's a genetic link there to use, just a what if)? Or other neurodivergence? Like being a troublemaker in class? Or voting for the party that doesn't control the medical incentive structure? Heck, let's stick with the fatal hereditary conditions, and say the editing does not affect germ cells. Is it ok if the human race gradually becomes dependent on gene editing to produce viable offspring? Or let's say it does extend to germ cells. The population with resources becomes genetically superior (eg in the sense of natural lifespan and lower medical costs) to those without, creating a solid scientific rationale for eugenics. Think of it as redlining carved into our blood.
I don't think discrimination against the genetically modified is the only potential problem here.
As humans, we'll deal with these problems the way we've dealt with everything else transformational. Namely: very, very badly.
If it turns out some pathogen or chemical made me autistic, regardless of whether or not I could be cured as an adult, I'd have certainly preferred to live the reality where I had been as a child.
I'm not going to claim that I know the perfect place to draw the line.
To me the wildest scenarios take this off the table.
Nothing in medicine is certain. Nearly any medical treatment has a small chance it could kill you. There’s a small, but non-zero chance of a lethal infection even if they injected you with saline, odds that rise dramatically in less than sanitary conditions.
Ironically the use of the attenuated oral vaccine for polio was because of the risk of infection in places where the availability of sterile syringes was hard to guarantee. It’s all about the relative odds.
I also think that gene repair is a net positive. I would just like us to, for once, look ahead and foresee some of the foreseeable consequences and act to mitigate them before the bulk of the damage is done.
I don't think it's necessary to slow the development; gene therapy is too desperately needed, and slowing it down so that we can prepare is not going to cause us to prepare.
Assuming requisite safety of course.
If we could make most children smart, productive, ambitious, courteous, civil, conscientious, honorable, strong... the value to society is probably high enough to justify covering it for almost anyone.
Somehow society (or indeed parts of it) decided to use it as a tool of further segregation rather than overall prosperity. I’m afraid same might apply to this.
I don't really see how this affects e.g. what I do for my children. I will absolutely be turning them into the closest to superhuman the current state of treatments lets me, traveling internationally if I need to. If someone else decides to segregate access to treatment, that is a separate, wrong act that will not hold me back from giving my children every advantage possible.
(Yes, I understand this is a positional arms race, but 1. that doesn't change the individually-optimal outcome, and 2. that doesn't change that society net benefits from it.)
I am, afraid, that this kind of genome modification will further increase divide in a society and turn social lifts off even more. I.e. it's not gonna be your kid to get "improve" brain genes first, and later your kid wouldn't get a chance to get it ever again for their children.
Just to be clear I'm not against of the progress, this thing is fascinating and really shows how awesome humans are. And I get why you'll get it if possible for your kid. I'm just not sure its benefits for the society mean it's gonna be anyhow affordable for regular people.
> use legal mechanisms to discriminate and persecute people who are genetically modified
I believe there is no way this will happen, because legal mechanisms are driven by the whims of the rich, and they will want gene editing to be legal. So there will beno legal mechanisms to discriminate against those who have been edited.
Please tell me there are measures to prevent this going into the wild. Please tell me this won't be used in large-scale industrial farming.
So the real trick here isn't the mRNA, it's the nanobubbles. Basically, you're putting these bits of mRNA into these little fat bubbles and then injecting those into the blood. Making those bubble shelf stable is really hard, hence the issues with temperature and the covid vaccine. To then make those little fat bubbles stable-ish in the blood is also a really hard thing to do. They have to get to the right places (in this baby's case, the liver) and then degrade there, drop off the mRNA, and not mess up other tissues all that much. Like, it's not terrible to make these micelles degrade in vivo, but to have them do that and not degrade in the tubes, ... wow... that is really difficult. There's a reason that Moderna is so highly valued, and it's these bubbles.
To try to then put these in a weapon that could do this though the airways would be, like, nearly impossible. Like, as in I think the second law of thermodynamics, let alone biology, and then simple industrial countermeasure like a N95 respirator, yeah, I think all of that makes it pretty much impossible to weaponize.
(Hedging my bets here: I don't know if they had to do all that with this baby, as you can kinda go from lab to baby really fast, since it's such a special case. But for mRNA based vaccines and cancer treatments, you have to deal with the shelf stable issue)
(Also, other bio people, yes, I am trying to explain to laymen here. Please chime in and tell me how I'm wrong here)
Something that a lot of people are unaware of is that US Military is allowed to do this. I forget the exact EO, but it was signed by Clinton and is in the 12333 chain of EOs. Mostly, this is used for the Anthrax vaccine. But, it does give clearance to do other forms of medical experimentation on warfighters.
No, really, I am serious here. This is true. I may have the details a bit off, so sorry there, but they can and do preform medical experiments on people without their consent. Now, to be fair, France does this too. They do sham surgeries over there. Non-consenting human medical experimentation is quite the rabbit-hole.
So, I can kinda see in the next 10 years, certainly the next 50, a routine shot given to warfighters to help them with things like blood loss, or vitamin C production, or fast twitch muscles, or whatever. The legal framework is already there and has been for a while, it's just an efficacy issue, honestly.
I cannot imagine a more effective weapon than an invisible gas that melts you alive, and there are MANY chemical and bio examples of these types of weapons.
That’s the story but it doesn’t hold up. Chemical weapons were used as recently as the Syrian civil war. I also think if they were really effective in modern warfare, Russia would have long ago deployed them in Ukraine.
More here: https://acoup.blog/2020/03/20/collections-why-dont-we-use-ch...
Nowadays we have riot control agents that can be tailored to demographics, react more violently in the presence of sweat, or contain psychoactive ingredients. Nanoparticle dispersion bypasses common gas masks and clothing protection. Even if you’re completely geared up, they can be engineered to last on surfaces for a long time, or react only in the presence of certain triggers. Imagine thinking you’re safe until someone turns on a certain light bulb and you cook inside your protective gear because you were actually exposed 12 hours earlier in an undetectable manner.
Additionally, that “if you can find them” is doing some pretty heavy lifting. The range of explosives and kinetics is hilariously low, and the actual percentage of your military with the level of mobility he seems to be referring to is infinitesimal.
This argument more correctly explains why chemical weapons aren’t a great defense against precision strike groups. It also doesn’t get into detail with concepts like dropping a bomb right in the middle of a firefight knowing it literally cannot harm your own troops, short of the physical metal accidentally falling on one of your own troops.
A terror attack on civilians is a lot different than modern militaries using them on each other.
Yes, it isn't effective outcome in terms of meeting their objective
> It also doesn’t get into detail with concepts like dropping a bomb right in the middle of a firefight knowing it literally cannot harm your own troops
That's a video games logic, it doesn't work like that in practice. Even civil grade riot control tear gas grenade is pretty traumatic because it still explodes to disperse the gas (source : implied first hand knowledge). That and warfare is messy, which means half the time half the protective gear will be destroyed from the usual exploding and shooting happening, gas gets carried away by the wind in a random direction, etc, etc.
No, it’s science. There are about a million ways to protect your own troops if that’s actually what you want to do.
It feels like you’re arguing against the idea of chemical weapons from the 1940s, rather than nearly a century later.
You don’t need protective gear. You can create sprays, lotions, inhalants, and other countermeasures that don’t stop working the second a piece of cloth rips. Shit, You could make a biological agent that avoids a DNA marker created with an mRNA vaccine. Likely not nearly as fast, but perfectly lethal.
Modern chemical weapons and biological weapons are absolutely incomparable to their Vietnam counterparts.
The reason that the body doesn't alarm as much to Pseudouridine, is that it's not a 'natural' RNA base. Meaning that, for the most part, nature really never uses it and so we haven't evolved to look out for it. Nature uses Uridine and so immune systems have evolved to look out for random bits of RNA in the body that use it and then clean that all up.
It's like if you're looking to clean up legos in you house with a romba that only cleans up legos. And all of a sudden it finds a duplo. It's going to take a hot second to figure out what to do with the duplo. And in that time, you can sneak by and build a duplo fort. (Look, I know this analogy is bad, but it's the best I can come up with on the fly, sorry. If anyone else wnats to come up with a better one, please do!).
The Pseudouridine is used up and degraded very quickly inside the cell, minutes at the very very longest, more like microseconds. It's just part of a messenger (the 'm' in 'mRNA') to tell the cell to do things.
You might see mRNA gene editing in factory farms, but it would just be easier to do germline editing instead and skip spraying animals, plants, and fungi. Why waste the equipment, right?
If anyone else does know, please chime in!
https://www.statnews.com/2017/01/10/moderna-trouble-mrna/
By the time COVID vaccines came around a few years later there was no evidence they had fixed the problems with lipid nanoparticle delivery. I looked for such evidence extensively at the time, for example, announcements by Moderna of breakthroughs or trials of new drugs. Today the situation seems not much different. Note that Moderna's wikipedia article has a section on "rare disease therapeutics" but it's literally empty:
https://en.wikipedia.org/wiki/Moderna#Rare_disease_therapeut...
Because of their failure to progress beyond COVID vaccines Moderna's share price got slaughtered, falling from a peak of ~$450 to ~$25 today.
I don't know if other companies were able to find breakthroughs here, after COVID I stopped following the topic. Unfortunately, although mRNA tech has great potential, when normal safety standards were reimposed it appears that Moderna went back to being unable to make anything safe enough to launch.
But we didn't take these vaccines once. We took many of them. Am I to understand a known side effect is liver toxicity for multiple doses?
It's easy to find papers discussing the problem, just search Google Scholar. Example:
https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1002/prp...
Integration was proven in 2024, unfortunately :(
https://www.medrxiv.org/content/10.1101/2024.03.24.24304286v...
"Of the S1 positive post-vaccination patients, we demonstrated by liquid chromatography/ mass spectrometry that these CD16+ cells from post-vaccination patients from all 4 vaccine manufacturers contained S1, S1 mutant and S2 peptide sequences"
They can tell the difference between vaccine spike and virus spike as the vaccine spike was modified for stability. The exact pathway is speculated to have been DNA contamination due to manufacturing process defects. Sequencing of vaccine vials has shown far higher levels of DNA contamination than is considered safe, and the lipids would bring DNA into the cells just as well as they do mRNA making the safe levels much lower still.
https://osf.io/b9t7m_v1/download/
https://www.medrxiv.org/content/10.1101/2024.03.24.24304286v...
But yes further study has to be made.
Given the merry movement to call the COVID vaccines gene editing, it rankles.
Do you know of any good resources that I can use to get up to speed on the exact methods they used for the baby?
My understanding, outdated as it is, is that we're using the mRNA to go in and create CRISPR-CAS9 slicers/dicers and additionally to that, the correct genes (not mRNA) to get stitched in. I would love to know more about how I am wrong here, as I am sure I'm not even close to really understanding it.
Thanks!
EDIT: well, I suppose the question is whether cells of living beings could produce the U required for the viruses. But if not, then a wild virus using U instead of T to bypass our immunity also would not be a threat for that very reason.
Basically, the real deal technology here is the lipid bubbles that deliver the payloads to the right cells, not the base modification. You can go look at them, and a lot of other comments in this thread for more info on that tech.
TLDR: No way that anyone can bypass anything. These lipid bubbles are a miracle that they work at all; they're so unstable, it boggles the mind we can even use them to begin with. Doing any large scale DNA editing on an unsuspecting population would be so insanely expensive and difficult, I certain moving to the Moon would be cheaper.
One of the treatments for sickle-cell involves switching off the gene that makes the malfunctioning red blood cells, but of course that's not sufficient; you'd stop making red blood cells completely and you'd die. So it's combined with a modification that switches on a gene that all humans express pre-birth that causes your body to make "super-blood": red blood cells with significantly more binding points for oxygen. This is necessary because a fetus gets oxygen from its mother's blood, so the increased binding affinity is useful for pulling the oxygen towards the fetus at the placental interface. After birth, expression of that gene is disabled and regular RBC genes switch on.
So the therapy doesn't "fix" sickle RBCs; it disables the body's ability to make them and re-enables fetal RBCs! I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant, I imagine increased-affinity RBC could help for athletics... But I also imagine it requires more iron to generate them so has dietary impact).
From shadowgovt:
> I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant
This was exactly the question that popped into my mind when I read about switching from normal adult RBCs to fetal RBCs: does this therapy reduce the likelihood of carrying a baby to term?
No problems really..never knew I had it until I was told I had thalassemia trait as part of genetic testing. My hemoglobin panel shows fetal hemoglobin.
This is even more great reading behind the above:
https://en.wikipedia.org/wiki/Jennifer_Doudna
https://www.lbl.gov/people/excellence/nobelists/jennifer-dou...
The fact that this treatment "built on decades of federally funded research" is the scary part, given that such funding may disappear.
https://en.m.wikipedia.org/wiki/Emmanuelle_Charpentier
After edits were disabled, I thought perhaps there's a page for Charpentier too, which there was, but later than i could edit.
They're both amazing scientists.
https://www.sciencehistory.org/stories/magazine/the-death-of...
This isnt entirely unlike the method mRNA vaccines use. Through some clever biochemistry, mRNA vaccines get bits of code into cells where the cell's built in code compilers manufacture proteins that induce immunity.
We have developed software patches for our biology.
> until it finds the exact DNA letter that needs to be changed.
This pine is disingenuous (at best). There is no way of guaranteeing where the DNA is inserted. It is designed to only slot into a very specific portion of the DNA but they don't have a way to control that precisely, the accuracy is high but "exact DNA letter" is skipping over a few pretty important details.
To be clear I'm not saying it is ineffective or unsafe, only that the claim made is marketing speak and not actually true.
I do still question their claim of 100% precise results though. At least based on that high level description I can definitely see it being safer, but I question any scientific claim that is an absolute.
Specific to the editing vs insertion mechanism, I question how it doesn't run into similar constraints where the mechanics of targeting exact portions of the DNA can occasionally miss or impact the wrong segment of DNA entirely.
I haven't dug as deeply down the base pair conversion though, so I could absolutely be wrong!
I had heard about CRISPR a while back but most reporting on it kind of hand waved over the mechanisms of how it actually accomplishes its work. What these researchers have figured out to make this work absolutely blows my mind.
They specifically tested for off target edits in the mouse study and found no harmful edits (and very rare off target ones). That plus the specific targeting of the liver cells (no germ line effect expected), makes this a low risk approach and certainly better than doing nothing.
An interesting part of the study was determining what a clinical dose _should_ be. You need enough to edit enough liver cells. But don’t really want to completely overdo it to limit potentially negative side effects. Seems like they got it right enough here, with the first dose having some effect and the subsequent dose having more.
The counterintuitive part is how fast thermal motion is relative to the size of dna.
In body temperature water, the thermal velocity of water molecules jostling around everything is ~600m/s. The nucleus of a human cell is ~6µm in diameter. That is, your average water molecule bounces around at a speed that makes it move from one end of the nucleus to another roughly 100 million times per second.
Larger molecules move more slowly, but they still zip around fast enough that nothing needs to "seek" to a specific position in a cell to get there, everything will touch everything just from thermal random walk in a very short time. So how biology works is that inside the cell there might be just one messenger, which will have to hit a specific piece of dna just right in order to do anything, but that's still nearly instantaneous from our perspective.
Essentially you can design an rna molecular that contains a 20 nucleotide long sequence that can target your region of interest, with the caveat that there is a standard recognition sequence proximal to your sequence of interest (PAM sequence)
https://en.wikipedia.org/wiki/The_Code_Breaker
You'll end up with mosaicism (cells with different DNA) but presumably you have enough of the new cells to fix the problem the original ones had.
You don't need to fix all the body, you just need to fix some of the, say, liver, and you're good.
> The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services.
For example it's no coincidence this is a liver disease as basically almost everything you inject in the bloodstream ends up concentrating in the liver by default - if you needed to target another organ with your LNP it would be much harder. Most of the time people are trying to stop stuff accumulating in the liver!
The liver has other special properties that are helpful as well.
Having said all that - it is still a massive achievement.
> That is one of the most incredible things I have ever read.
Biology is incredible - and you can do incredible things if you leverage it.
solvable
- able to dissolve in solvent
- able to be solved.
Here is a use in the title of a quite famous popular science book from the 1960's.
https://www.routledge.com/The-Art-of-the-Soluble/Medawar/p/b...
And an Editorial piece (more technical than the NYT): https://www.nejm.org/doi/full/10.1056/NEJMe2505721
It’s crazy encouraging that this worked out for this kid, and I’m somewhat shocked this treatment was approved in the US - I don’t think of us as very aggressive in areas like this. But to me, really hopeful and interesting.
Right off the bat, the liver receives roughly a quarter of all cardiac output, either directly or second hand from the digestive organs. Additionally, the liver has a fenestrated endothelium which, while not completely unique in the body, uniquely allows molecules like lipid nanoparticles (LNPs) to access liver cells. Finally, the liver is the site of most lipoprotein processing, and LNPs can be designed to take advantage of the existing pathways to get the gene editing mRNA into the hepatocytes. All this is to say that if you have a genetic condition that primarily effects the liver, there's a lot more hope for treatment in the near term than for others.
Good lecture on the difficulties of finding appropriate platforms for delivering gene therapies to cells for anyone interested [1]
[1] https://youtu.be/6URTjoK58Yc
mRNA vaccines are highly localized: you get a sore arm because most of it only gets taken up by muscle cells around the injection site, which spend some time producing the antigen and triggering a primary immune response (the inflammation aka the sore arm).
As for being localized it's true however after vaccine dose S proteins have been detected also in remote locations in the body because you can't make something 100% localized.
If you had an infusion that doesn't trigger immune system you could just increase the dose significantly, put it in the blood and most likely it would have reached all cells that blood reaches.
But I'm speculating a bit here.
I can remember getting a sniffle at night and waking up fine the next morning a few times.
I think I had two doses of covid mRNA vaccine.
I have actually forgot what it is like to be sick. It almost feels like the covid vaccine gave me some kind of super immunity. I never get the flu shot either. I have not had the flu in 5 years for sure.
People born with this lack the enzyme CPS1, which screws up the urea cycle and causes a build up of ammonia. Ammonia build up is bad for your nervous system.
As to the FDA stance, it tends to be more willing to go ahead with compassionate uses like this when it's clearly life or death.[1]
[1] https://www.statnews.com/2025/05/15/crispr-gene-editing-land... This discuss a little of the FDA stuff but not much more detail, it sounds like they did let them skip some testing.
There could be other babies that can also grow up to be future Hitlers. So let's say 4 such babies exist. By killing one I eliminated 1/4 for futures with Grown up Hitlers that exist.
This whole thread is getting flagged. Likely by an irrational parent who can't even compute natural selection, babe, and Hitler all in a single paragraph.
It’s perfectly reasonable to say that while a technology has the propensity to be used for evil, it also has positive applications and that the real benefit now outweighs the potential downside in a hypothetical future.
Otherwise you will go down a rabbit hole at the bottom of which lies a future where we all just kinda dig in the dirt with our hands until we die because every technological innovation can be used in a variety of ways.
Like, it’s silly to me that I can’t bring a 1.5” blade keychain utility knife on a flight, and then they hand me a metal butter knife in first class. I could do way more damage with that. But they allow the butter knife because the utility has shown to far outweigh the potential downside that hasn’t manifested.
> I will slaughter a baby if I know for a fact that baby will grow up to be the next Hitler
This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
It's true. But things like this should be easy to say right? Like we may not be able to act logically. But we should be able to think logically, communicate logically and show that we are aware of what is logical.
My post got flagged meaning a lot of people can't separate the two things. So for example I may not be able to kill the baby in reality, but I can at least see how irrational I am.
The person who flagged me likely not only can't kill the baby. He has to construct an artificial reality to justify why he can't kill the baby and why his decision must be rational.
It would maybe be easier for a 15-25 y.o. to kill a baby they don't know and whose parents/family they don't know, and maybe even easier if they don't speak their language or look like them. Of course, the baby wouldn't be the only one you'd have to kill, most likely.
I submit that it would be very very different if you found out that your 4 year old child was going to go on to be the next Hitler. For a "normal" person, I think they would go to the ends of the earth to try to shape them into the kind of person that wouldn't do it. I think very few people would coldly calculate "welp, guess I gotta execute this adorable little child I've grown so attached to" as it looks up at them saying "I love you so much forever, mommy/daddy" with their little doe eyes.
(ETA: it also brings up side questions about nature vs nurture and free will)
And then consider the lifelong repercussions of the emotional fallout. You can use all the logic in the world to justify the action, but your human brain will still torment you over it. And likely, most of the other human brains that learn about it would torment you as well.
---
So, while I think you can say things like that, ie the ability and allowance, I think you should question whether you should. I think saying those kinds of things really doesn't add much to the discussion because I believe it's really just an uninformed platitude that only someone with a lack of life experience would believe.
For me this all highlights the fact that meaty ethical questions don't have a simple reductive answer. Which ties back in to the original problem that OP outright states that this is simply and clearly the wrong path to go down.
(PS the downvoting/flagging could be due to breaking the guidelines around discussing downvotes and flags, and not actually due to the topical content of the posts, and/or assuming bad faith on the part of other users as such: https://news.ycombinator.com/newsguidelines.html)
You should because many choice in life are not strictly black and white. Saving a babies life versus introducing gene editing to humanity. If there was a baby where we knew he would grow up to slaughter millions it's absolutely worth talking about. In the age of AI and gene editing where things are influencing what it even means to be human, it is wise to stop and pause for a minute to ask the right question rather then charge forward with change that can't be taken back all because we wanted to save a baby.
Answering the real question- it's unlikely these techniques will see widespread "recreational" usage any time soon, as they come with a wide range of risks. Further, the scientific community has learned a lot from previous eugenics programs; anything that happens in the future will happen with both social and political regulation.
It's ultimately hard to predict- many science fiction writers have speculated about this for some time, and social opinion can change quickly when people see new developments.
It will be that people just don't have children at all.
If you want make your baby smarter, taller, or more handsome, it's not so easy because these traits involve 1000s of genes.
For this reason I do not think that curying diseases will lead to designer babies.
I'll steelman "fixing defects" by sticking to serious hereditary diseases (and yes, only those that correspond to one or a few known genes). As more and more conditions become treatable, the population with access to resources will have lower healthcare costs by being less susceptible to problems. (Which is a good thing, note!) Insurance companies will have more and more proxies for differentiating that don't involve direct genetic information. Societally, "those people" [the poor and therefore untreated] cost more to support medically and are an increasing burden on the system. Eugenics gains a scientific basis. Do you want your daughter marrying someone genetically substandard, if you don't have the resources to correct any issues that might show up? Probably not, you're more likely to want to build a wall between you and them. Then throw over anyone who falls behind the bleeding edge of corrections.
It'll be the latest form of redlining, but this time "red" refers literally to blood.
But, I think that it's misguided to apply the human problem of othering to a given technology. Regardless of technology X, humans are gonna human. So, if X helps some people, we should consider it on that basis. Because without X, we will still have an endless stream of other reasons to draw red lines, as you allude to. Except in addition we'll also still have the problem that X could've helped solve.
If gene editing to cure diseases leads to a future where people want to shunt off the poor that are now the outsized burden of the healthcare system, the answer from where I sit is to find ways to make the gene therapies available to them, not to cart them off to concentration camps while they await extermination. This will require all the trappings of human coordination we've always had.
Preventing X from ever coming to fruition doesn't at all prevent all possible futures where concentration death camps are a possibility. To me they are orthogonal concerns.
Even if you can convince one culture/society not to do it, how do you stop others? Force? Now you have a different manifestation of the same problem to solve. Society needs to learn how to "yes, and..." more when it comes to this stuff. Otherwise, it's just war all the way down.
> This will require all the trappings of human coordination we've always had.
It is also true to say that we've never had it as quickly as it has been needed, and neither is it done as well as it needs to be. We will blunder into things that are easy to predict in advance if we are willing to look and accept what we see, but we won't.
I absolutely agree that this advance is a great thing and should be pursued further. But I also think that simply categorizing it as good or bad is a way to willfully ignore the unintended consequences. We should at least try to do better.
> Society needs to learn how to "yes, and..." more when it comes to this stuff.
Absolutely. I just think that requires nuance, wide open eyes, and acceptance of uncomfortable truths. Part of the nuance is not boiling it down to a yes/no question of "should this proceed?" (For example, how about: "How can we utilize these new capabilities to maximize benefit and minimize harm, when the only real lever we seem to have to work with is the profit motive? Everything else is getting undermined in its service.")
Well, you're wrong. Where is the line drawn for what constitutes a disease? Retardation? Autism? Eventually every child below, say, 130 IQ will be considered disabled and unable to find work.
Apply this to every other trait: cardiovascular health, strength, height, vision, etc. All forms of weakness can be considered a disease. The end product of eugenics is that mankind will be made into a docile and fragile monoculture.
>If you want make your baby smarter, taller, or more handsome, it's not so easy because these traits involve 1000s of genes.
And? it's obvious that the technology will eventually be capable of this, just not all at once. It starts with single-gene mutations, then it will be 10's of genes, and then hundreds and thousands.
That is the slippery slope: there is absolutely nothing about your reasoning that prevents one step from leading to another.
It's helpful to evaluate claims on this thread in the context of the story. It's possible (though still a very open question) that complex behavioral traits will generally become predictable or maybe even controllable in the future. But those would require breakthroughs (including basic science discoveries breaking in the direction baby-designers want them to) more significant than the announcement on this story.
There's no inherent metaphysical worth in being on any particular level of strength, height etc., so we can spread whatever is the most convenient. I think arguments against (that I see being made) ultimately devolve into some magical thinking and a priori thing bad. (I am glad to be shown otherwise.) In fact we are already messing with human fertility in possibly unsustainable ways, so maybe more tools are needed as a part of the way out.
Of course there is political execution, corruption etc., but I don't see it any different from other technological challenges that civilization has dealt with. I.e. we need better politics but the tech is not at fault. Gene editing is isolated interventions, so it's in that detail more manageable than for example mass surveillance which is hidden and continuous.
One more esoteric argument is that we cannot socially agree on what traits are desirable. The ‘The Twenty-first Voyage of Ijon Tichy’ scenario. So opposite to "monoculture" in a way. But I don't see people expanding on that.
Unless those other countries step up and fund it themselves.
They might. They might not.
The technology used on this same article was funded by Max Planck (Germany), Sweden and the NIH to a french and a USA scientist. Should those collaborations stop?
That is changing. Children in my country are moving from learning English to French and German in order to study in European universities. This started after Brexit and will accelerate now.
By pooling our funding / effort we can create a larger body of collaborators to solve problems faster and better.
It could be that the organizations are funding wild stuff that isn’t salient. I’ll concede that.
However, in basic sciences there are so few specialists it is important to share resources. The funding is worse than ever (hello 2006!), and that trend is unlikely to reverse for a while.
Source: I worked in bioenergetics for 10y, my collaborators were from Hungary, Chile, Canada, Israel, Italy, and more! At a major conference on mito energetics they all fit in one big lecture hall (100ish?)
I guess it's still too early in this story's news cycle for the people with anti-views to be making noise yet. No GMOs, but human gene modification is okay. No cloning either. The boogeyman is gonna get us no matter what we do
Indiana Jones and Hellboy are pretty explicit about this.
Eh?
See: Joe Rogan, Ben Shapiro...
It is breathtaking to consider how the members of the Administration and their children, parents, and grandparents have benefited from NIH-funded research in innumerable ways that they are shamefully unaware of, every time they visit the doctor or the ER.
They have created a huge rift in this country and I am still trying to figure out if I will forgive my family members and what they'd have to do to set us on a path towards reconciliation.
When there's a contract in place to conduct pediatric cancer research, and the government decides one day to break that contract, and it takes courts to rectify the situation, and then the government defies the courts, and the voters are cheering on the illegal actions of the politicians, well, rage is a mild word for what I feel.
See also: the paradox of intolerance.
Consider that everyone sees themselves as the hero… but that doesn’t mean you actually are, maybe, just maybe you are just as culpable as the person you’re accusing.
Republicans are currently the ones undermining the foundations or our republic, stripping rights from minorites (Texas just passed a bill that made it illegal to be trans), deporting people with no due process, arresting dissenting politicians and academics.
They're the ones plunging this country into economical ruin, destroying medicare and medicaid to transfer the savings to the 1% through massive tax cuts while letting everyone that depended on these programs die.
Everyone in support of these ideas is intolerant in my book, and I don't see why I should show empathy to a people that would rather see me in a camp.
Just based on the stuff you say here it’s pretty clear you very closely align yourself with “progressive values”. Many studies show that those who hold progressive beliefs, struggle to even accurately articulate the values and beliefs of those they believe they appose. Much less actually understand them.
You very clearly exhibit this behavior as well.
If you can’t understand the person who’s talking opposite you there is no way to come to an understanding, if you refuse to attempt to understand them, you can’t blame them for the state of animosity.
But apparently the partisanship is reversed! You think that I am demanding "perfect empathy" (I am not) and you think I have now shown empathy for my family members (which, you don't know the history). You are describing narcissistic behavior, which is quite endemic in my family members, and having dealt with it for decades I also recognize the attempt to blame others for one's own failing.
Yes, it is all breathtaking, but not in the way you think.
Edit: Still reading the article, but so far researchers working in the US have come from India, Russia, born to Taiwanese immigrants, and more.
Heck, if parents could provide a trust fund for their kids in a way that their kids couldn't piss it away, they'd be all over it. (I'm sure this exists to varying degrees.)
Look at what wealthy parents already do to get their kids into colleges or out of jail. I think it's ridiculously naive to think that we parents wouldn't jump at the chance to write generational wealth into our kids' genes.
(This is not an argument that developing this capability is a bad thing and should be stopped.)
Gattaca was a film years ahead of its time, and raises the question of what happens when people try to "fix" human beings beyond disease prevention. A subtle, but important ethical difference. =3
The more we things we cure the higher we will reach and the higher we reach the higher we will raise the bar. I don't think that's a bad thing, but its worth bearing in mind.
I think it is more likely people will create synthetic diseases by experimenting on human beings with unique unpredictable gene expression.
He Jiankui already crossed the ethical boundary in 2018... only to discover his best intentions were still nonsense. The GMO kids he helped edit will have a lifetime to figure out if that alteration negatively affected them, and as adults consider how their own children may change.
People may cross the "Primum non nocere" line, but it can never ethically be justified =3
From an evolutionary perspective it‘s interesting how the further medicine gets, the more we inherit genes unfit for life without medical support.
No, it would not depend on the sex of the baby, as the chromosomes that you're editing aren't X or Y.
Evolutionarily, the inheritance of genes is a far slower process than the medical advancements we make, so what I think we're seeing here is a chasing down of the low probability events. In that, most of the evolutionary pressure is coming from things like dirty water and bad food, but as we're solving those low hanging fruit, we have to go to lower probability events to make progress that feels equally important.
Also, if I am wrong here on the answers to the questions, please correct me!
Organs in your body usually keep some very old cells (formed in the embryo) around which act as parents for all the new cells in an organ. Any cell can only divide a limited number of times, so they typically maintain a "tree structure" where the old cells create children and grandchildren (etc) that then differentiate into the organ-specific cells that do the actual organ work.
If you modify only the differentiated cells, eventually they die, and are replaced by descendents of stem cells; if those stem cells didn't get modified, their descendents will not have the fix, and the treatment efficacy reduces over time.
Stem cells from other organs has absolutelly nothing to do with this. Unless you are refering to procedures of planting stem cells from one organ to another to help failing organ, as stem cells are universal cells, that are able to produce cells for any organ.
Anyway, this baby proves we can fix hereditary diseases now.
That comes in many forms:
Black/dark one, nazi style, where you outright sterilise or even kill those with unhealthy/bad genes.
And white/peaceful one, where you‘d appeal to those with unhealthy/bad genes not to procreate and encourage those with healthy/good ones to do.
You can‘t seriously tell me it‘s not extremely unethical for people with huntington‘s disease or cystic fibrosis to have children.
>>>You can‘t seriously tell me it‘s not extremely unethical for people with huntington‘s disease or cystic fibrosis to have children. Don't flatter yourself - your genes are basic and ridddled with bad genes. You do not know what time bomb you are carying in your DNA.
The solution that you are offering is quite simple - procreate early as possible and die not in old age and voila - there are no issues in more than 99.99% cases. But something tells me that you are already older than healthy monkey and do not plan to live in a tree - your bones are too old for that and thanks to evolution are not meant for that.
Evolution of humans in future includes even longer lifespan which naturally comes with children produced at much later age than we do now and that comes with diseases to be dealt with, as that is part of evolution. We do not know much about mutations in DNA - they are never good or bad - they are combinations of something. For example - diabetes type 2 seems to be from genes, that allowed humans to survive hunger for long period of time - are those genes bad, because people are obese nowadays? As for mentioned diseases - we value other humans not by DNA, but what they are to us. You would sing a different song, when their offspring would have any of such disease and you are in luck and not planning to have any.
Second, according to a quick search, 10% of cases of Huntington's Disease are due to new mutations; I suspect (but I'm a HN commenter, no geneticist) this is the case for many other genetic conditions.
So the other ethics question to ask: should people be able to get DNA tests for genetic conditions (voluntary)? I'd say yes. Should people be mandated to get DNA tests and be forbidden to procreate if there's something in there? No, that's eugenics. Should people who know they have a genetic condition and there's a chance their child has it too have children? That'd be their choice. I don't think it's fair for people to intentionally place a burden on health care systems like that, but thing is, there's very, very few people that have children with that as the intent.
Yeah I'm sensitive about this. I like many other parents of children who have been lost to genetic disease have good reason to be.
Really incredible story and I'd love to know the process for receiving this, for example FDA approval etc. It's nice to see such in-your-face results from Federal funding programs. Without being political, it's sometimes hard for regular people to appreciate just how much good actually comes out of Federal Funding. There was another thread where someone even said something along the lines of : "Well during war things get done faster" . This simply isn't true. It might be done louder but Federal Funding never stopped pushing things forward.
"The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services."
"But KJ’s treatment — which built on decades of federally funded research"
"The result “is a triumph for the American peoples’ investment in biomedical research,” Dr. Urnov said."
"The researchers emphasized the role government funding played in the development."
"The work, they said, began decades ago with federal funding for basic research on bacterial immune systems. That led eventually, with more federal support, to the discovery of CRISPR. Federal investment in sequencing the human genome made it possible to identify KJ’s mutation. U.S. funding supported Dr. Liu’s lab and its editing discovery. A federal program to study gene editing supported Dr. Musunuru’s research. Going along in parallel was federally funded work that led to an understanding of KJ’s disease."
"“I don’t think this could have happened in any country other than the U.S.,” Dr. Urnov said."
This is an article about federal funding of medical research with a cute baby as the human interest bit.
https://innovativegenomics.org/news/first-patient-treated-wi...
> the idea of being told my 1 week old baby is going to die
not
> the idea of my child dying
> my baby is going to die, woe is me
and more of
> have I failed my baby so much as a parent that he won’t even grow to adulthood (much less have a wonderful, happy life)
It’s not exactly a rational feeling; it’s not like this baby was going to die through lack of parental effort or care or anything else that the parents have any real control over, so it’s not like they could have done anything differently.
Nonetheless, it can make you feel like an utter failure of a parent. To some people (I admit, not everybody), that is absolutely crushing.
It only looks irrational if you don't understand what people and feelings are.
I am not a parent but I think if I did have a kid I would try everything I could to keep my child alive and minimize pain in my child's life.
Humans see value in living life, so cutting a life short is worse than a life that would be ending soon anyway.
This really has nothing to do with the inevitability of death. Death is inevitable, however there is a difference between a child dying and an elderly person dying. A child has potential, they have not lived their lives. A child has not actually lived the full basic human experience, they havent had a crush, or fallen in love or married or had children or had any great successes or failures or close friends or anything, these things everyone does. An older person has, they are not a pure soul who hasnt experienced life. After 70 years you can be sad for the individual passing but happy that they have experienced life. This is why when a parent has a child they arent sad that their child will die in 80 years, but are devasted if they die at a week. The child never even had a chance. When you actually have a child, its an emotional and fulfilling experience, and to have that torn out so early is damaging.
From an empathy and emotional pov these things are so extemely basic and foundational aspects of being a human, a 10 year old from any culture on earth can undersrand this with no difficulty. And any person with even a passing familiarty with logic, ethics or philosophy will dismiss you as being earnest. Which is why people are assuming you are a troll.
So what? So a father shouldn't celebrate medical advances that mean their kid doesn't have to die after a week? And if it does, they should just be like "Ah, that's life!"
I would be deeply unhappy to learn that my children won't live to old age.
Also witnessing the death of a loved one is obviously traumatic. People grieve their parents dying of old age.
> But your child will die and that's a fact. Is it only ok for it to die after you?
https://news.ycombinator.com/newsguidelines.html
I tried to be the one who didn't do that, but missed the mark. I'd delete it if I could.
Please observe the guidelines, especially these ones:
Be kind. Don't be snarky. Converse curiously; don't cross-examine. Edit out swipes.
Comments should get more thoughtful and substantive, not less, as a topic gets more divisive.
Please don't fulminate. Please don't sneer, including at the rest of the community.
Please respond to the strongest plausible interpretation of what someone says, not a weaker one that's easier to criticize. Assume good faith.
Eschew flamebait. Avoid generic tangents. Omit internet tropes.
Please don't use Hacker News for political or ideological battle. It tramples curiosity.
https://news.ycombinator.com/newsguidelines.html
I genuinely can't link any of these to any of my comments, that's why I'm asking. I reread those a couple of times. I really think I've been polite, and I really tried to be, even when called "beteft of humanity", "earnest" and accused of trolling. I did not insult anybody, didn't want to and I certainly didn't want to bring anyone down. I just asked a question that seemed (and still seems) logical to me, only to get shutdown by mass flagging, now by removal of the comment with no real explanation what rules I broke and why I was negative
Please just understand that it can be upsetting to many people in the HN audience, as evidenced by the votes and comments, when the topic of death is addressed in this way: i.e., in a way that seems hyper-rationalist and diminishing of the way premature death – especially of infants and children – is particularly devastating to parents and loved ones.
I might be just shit at expressing my thoughts in English
> when the topic of death is addressed in this way: i.e., in a way that seems hyper-rationalist
This is why I kept pushing and asking - I thought that HN is all about logical thinking and not letting your emotions go through and think for you.
I don't know if you are still insisting that I broke the rules - you don't have to explain in which way I broke them, I understand that I don't understand. A simple yes or no would suffice, if I could ask you.
And thank you for taking the time for discussing this with me. Regardless of the answer for the above question I will refrain from talki
How many people can even afford to get multiple opinions for a weird lump on their back? Or go to the dentist for a strange toothache? How many people can afford to get consistent exercise and eat healthy? How many lives would be saved or at least massively bettered? We already have the means to extend the life expectancy of the average person, and it's not being used. Obviously this is a wonderful medical advance, but it's depressing to wonder who it's for.
Observe that the replies to my post do engage with the argument I made.
I'm as negative about the rich and powerful as anyone but this is such a cynical take - that might have been applied to many medical treatments in the past that have become relatively commonplace and easily accessible to people of all classes, at least in sane countries with sane healthcare systems.
I'm explicitly not saying this work shouldn't be done, it should! But it does not exist in a vacuum, and it would be silly to pretend that it is not colored by vastly unequal access to modern healthcare. The reason I get excited about technology is because of the potential it holds for making us all happier and freer to do the things we like for longer. We are lost if we do not at least speak about the thunderclouds on the horizon for this philosophy of technology.
I think, every once in a while, it's okay to just celebrate without looking for the the clouds :)
Everyone could afford to "eat healthy" and get exercise if governments and social planners put in a modicum of effort. Unfortunately they aren't directly incentives to do so.
Framing either of these things as a wealth issue ignores both how wealthy even the poorest in the world are and the systems responsible for the problem. For everything else there's health insurance, yet another horribly mismanaged system.
Please observe the guidelines, especially these ones:
Be kind. Don't be snarky. Converse curiously; don't cross-examine. Edit out swipes.
Comments should get more thoughtful and substantive, not less, as a topic gets more divisive.
Please don't fulminate. Please don't sneer, including at the rest of the community.
Please respond to the strongest plausible interpretation of what someone says, not a weaker one that's easier to criticize. Assume good faith.
Eschew flamebait. Avoid generic tangents. Omit internet tropes.
Please don't use Hacker News for political or ideological battle. It tramples curiosity.
https://news.ycombinator.com/newsguidelines.html
Three interesting thing come out of it from me. First, I was on Microsoft insurance which was quite gold plated at a time, a blessing only obvious in rear-view mirror, because Childrens was quite excited to continue any number of tests. Second, the technology of all this is absolutely amazing and I am so happy that it was available to me, and it has likely gotten better. Three, I want that tech to continue to expand and current destruction up there is going to hand this torch to someone else, which makes me sad.
One of the biggest perks of working for Microsoft for a long time was their health coverage. I can't tell you the number of times I'd be doing initial paperwork for a doctor's appointment and the receptionist would be like, "Oh you have THAT insurance, we're going to do all of the tests." I've heard they since cut back on it a little, but it truly was gold plated.
What America really needs is an NHS not tied to employment or exploited by fraudsters delivering worse care for profit. Human rights shouldn't be perks of employment.
Pretty much every lab test is available in Australia if you are willing to pay for it; if they don’t have a local lab capable of running the test, they’ll send the sample overseas
The real question is whether it is covered by insurance or not, and a lot of the time the answer is “no” - I recently forked out over US$500 for genetic tests on one of our kids (which the paediatrician recommended), although the results weren’t particularly helpful (“rare variant of uncertain clinical significance”)
For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body.
We still are struggling in most cases with how to deliver the DNA update instructions into the body. But given the pace of change in this space, I expect massive improvements with this update process over time.
Combined with AI to better understand the genome, this is going to be a crazy century.
Further reading on related topics:
https://www.lesswrong.com/posts/JEhW3HDMKzekDShva/significan...
https://www.lesswrong.com/posts/DfrSZaf3JC8vJdbZL/how-to-mak...
https://www.lesswrong.com/posts/yT22RcWrxZcXyGjsA/how-to-hav...
They think that the key to scientific thinking is to forego the moral limitations, not to study and learn. As soon as you're free from the shackles of tradition you become 100% rational and therefore 100% correct.
Like, I'm sure there are people who approximately match the description you're giving here. But I've spent a lot of time around flesh-and-blood rationalists and EAs, and they violently diverge from the account you give here.
The key to scientific thinking is empiricism and rationalism. Some people in EA and lesswrong extend this to moral reasoning, but utilitarianism is not a pillar of these communities.
On the other hand, maybe that is some kind of fallacy itself. I almost want to say that "scientific thinking" should be called something else. The main issue being the lack of experiment. Using the word "science" without experiment leads to all sorts of nonsense.
A word that means "scientific thinking is much as possible without experiment" would at least embedded a dose of skepticism in the process.
The Achilles heel of rationalism is the descent into modeling complete nonsense. I should give lesswrong another chance I suppose because that would sum up my experience so far, empirically.
EA to me seems like obvious self serving nonsense. Hiding something in the obvious to avoid detection.
A good name might be rational Altruism because in practice these people are from the rationalist movement and doing Altruism, or what they feel is Altruism. But the "rationalist" title suffers from similar problems.
They might have lost the plot somewhere along the line, but the effective altruism movement had some good ideas.
Color me unconvinced. This will work for some situations. At this point, it's well known enough that it's a target that has ceased to be a good measure (Goodhart's Law).
The usual way to look at this is to look at the percentage of donations spent on administrative costs. This makes two large assumptions: (1) administrative costs have zero benefit, and (2) non-administrative costs have 100% benefit. Both are wildly wrong.
A simple counterexample: you're going to solve hunger. So you take donations, skim 0.0000001% off the top for your time because "I'm maximizing benefit, baby!", and use the rest to purchase bananas. You dump those bananas in a pile in the middle of a homeless encampment.
There are so many problems with this, but I'll stick with the simplest: in 2 weeks, you have a pile of rotten bananas and everyone is starving again. It would have been better to store some of the bananas and give them out over time, which requires space and maybe even cooling to hold inventory, which cost money, and that's money that is not directly fixing the problem.
There are so many examples of feel-good world saving that end up destroying communities and cultures, fostering dependence, promoting corruption, propping up the institutions that causing the problem, etc.
Another analogy: you make a billion dollars and put it in a trust for your grandchild to inherit the full sum when they turn 16. Your efficiency measure is at 100%! What could possibly go wrong? Could someone improve the outcome by, you know, administering the trust for you?
Smart administration can (but does not have to) increase effectiveness. Using this magical "how much of each dollar... ends up being used to fix some problem" metric is going to encourage ineffective charities and deceptive accounting.
As someone who has occasionally given money to charities for homelessness and the like I don't really expect it to fix much. More the thought that counts.
In reality, they're simply lay people who synthesize a lot of garbage they find on the Internet into overly verbose pseudo-intellectual blog posts filled with both the factual inaccuracies of their source material and new factual inaccuracies that they invent from whole cloth.
I posted a question where I referred to something by the wrong name.
Someone said I was confused / wrong, so I corrected myself and restated my question.
For some 10 minutes they just kept dogpiling on the use of the wrong term.
Never a bunch a stupider people have I met than LessWrong people.
50 replies arguing about how you can simplify your for() loop syntax and not one reply with an actual answer.
I still think there's a lot to learn from those articles for most folks uninvolved in this area, even if some of their immediate optimism has additional complications.
I think what I mostly took away is a combination of technologies is likely to dramatically change how we have babies in the future.
1. We'll make sperm/egg from skin cells. This has already been done in mice[1], so it is not science fiction to do it in people.
2. When we're able to do this inexpensively, we could create virtually unlimited embryos. We can then select the embryos that have the most optimal traits. Initially, this may be simple things like not choosing embryos with certain genes that give higher risk of certain diseases.
This may involve selecting traits like intelligence and height (there are already companies that offer this embryo selection capability [2]).
3. Instead of creating a lot of embryos and selecting the best ones, we could instead create just one embryo and edit the DNA of that embryo, which has already been done in humans [3]. Alternatively, we could edit the DNA of the sperm/egg prior to creating the embryo.
The fact that none of this is science fiction is just wild. All of these steps have already been done in animals or people. Buckle up, the future is going to be wild.
[1] https://www.npr.org/sections/health-shots/2023/05/27/1177191...
[2] https://www.theguardian.com/science/2024/oct/18/us-startup-c...
[3] https://www.science.org/content/article/chinese-scientist-wh...
- how further can we push this to make the best, most optimized human?
- what are moral implication of this?
- what are the side effects / downsides?
What gets harder are polygenic traits that even today we don’t have great data on what are the causal alleles. But that is also not a technological limitation either but a statistical one from insufficient sampling of these polygenic phenotypes.
There are lots of hereditary illnesses and conditions that could probably be tweaked with DNA editing, if we can identify the responsible genes. If someone can cure male pattern baldness they’ll be rich.
Eventually this will be the outcome of our species to edit the gametes themselves. The issue to overcome for this again won’t be technological as that is pretty much solved but getting people over their own “ick” factor.
>>>Eventually this will be the outcome of our species to edit the gametes themselves. The issue to overcome for this again won’t be technological as that is pretty much solved but getting people over their own “ick” factor. This is a new fear unlocked, as this will be like another cosmetic surgery procedure, which from my minimal understanding does not affect DNA that is delivered to offsprings - that could be changed but require a lot more work, but like you mentioned - it is easier to do before fertilization :). It is catch22 situation rn.
Probably requires getting investors over their profit incentive first, why treat a heritable disease for the offspring if you can charge them on a per person basis?
How to avoid having only parts of the liver with the new DNA, and some other parts with the old DNA? Like a chimeric liver - isn't this something bad?
In fact, gene editing completely removes the need for eugenics programs.
Somatic editing is becoming more common (see Casgevy) but there are technical hurdles that prevent its application to many cases.
Genuine question- how do we know that? Is it just that the edits are very improbable to accumulate in the gonads in sufficient quantities to persist? We can’t actually prevent some fraction of them from reaching other parts of the body, right?